The middle of an mRNA molecule contains the nucleotide
Biology, 15.04.2020 02:44 jamalchris9353
PLEASE HELP (WORTH 50 POINTS)
The middle of an mRNA molecule contains the nucleotide
sequence shown here. Much more of the mRNA is translated.
Assume that the sequence is translated from left to right.
AUUUAACUGUUCUGUCUAGAG
Construct an Explanation Based only on the information provided, why could the mRNA
section be translated into three different sets of amino acids, instead of just one set?
Answers: 1
Another question on Biology
Biology, 21.06.2019 14:00
Texas bluebonnet plants seen in this photo are an example of which ecological unit?
Answers: 1
Biology, 21.06.2019 21:30
Facilitates growth and change in neurons and the migration of neurons to different sites in the brain
Answers: 1
Biology, 22.06.2019 06:30
Ascientist is conducting an investigation that involves water, silver, carbon dioxide, and oxygen gas which group of statements best describes all of the materials he is using in the investigation?
Answers: 2
Biology, 22.06.2019 10:30
Nkentucky, intoxicating beverages (beer, whiskey, wine, etc.) are involved to some extent in approximately % of collisions fatal to pedestrians.
Answers: 3
You know the right answer?
PLEASE HELP (WORTH 50 POINTS)
The middle of an mRNA molecule contains the nucleotide
The middle of an mRNA molecule contains the nucleotide
Questions
Mathematics, 20.08.2021 05:40
Mathematics, 20.08.2021 05:40
Spanish, 20.08.2021 05:40
Mathematics, 20.08.2021 05:40
Chemistry, 20.08.2021 05:40
Geography, 20.08.2021 05:40
Mathematics, 20.08.2021 05:40
Mathematics, 20.08.2021 05:50
