The purpose of antibodies is to .a. poke holes in the cell membrane of an invader to cause extracellular fluid to enter the cell making it swell and b. eventually rupture the cell membrane. c. inject toxins into the invading pathogen to destroy it. d. inactivate its DNA so the pathogenic cell is unable to function. e. mark the invading cell for destruction and to prevent the invader from interacting with other cells.

What does polymerase chain reaction (pcr) do? o a. separates dna fragments by size o b. cuts a dna sample into fragments o c. provides an overall picture of a person's chromosomes o d. makes more copies of a sample of dna

What is the main reason that attitudes are more often revealed in spoken rather than written language? a. in writing, we try to put the "best face" on what we write. b. we speak far more often than we write. c. in writing, we can more easily conceal our attitudes. d. in spoken language, we are often careless in our use of words.

Due i have no idea on this brainliest to the best answer. case #28104 last month, hudson national bank was robbed by an unidentified man. the robber wore gloves, a hat, and a bandana that covered his face. a security guard attempting to stop the robber was knocked unconscious in a struggle. however, the guard managed to pull the hat from the robber's head. witness accounts and security tapes led police to arrest three possible suspects. none of the suspects have alibis, but police are not certain which man is the robber. using hair samples from the hat recovered by the security guard, the crime lab did a southern blot test. hair samples were also taken from each suspect. use the suspects' hair samples to determine the guilty party. suspect a tccatcca / tccatccatcca / tcca / ggcttacctataagg / tggatggatggatggatgga suspect b tccatcca / tccatccaattg / tcca / tccatccatccatccatcca / tggatggatggatgga suspect c ttagcta / ccggtatga / aggt / cgttatcggatata / ggttaggacctatcgataga probe aggt questions answer these following questions in the essay box below. a. which suspect most likely committed the robbery? b. how do you know?