subject
Biology, 15.04.2020 20:02 artistictype4671

Houses have been built around a small retention pond, increasing the fertilizer runoff into the pond. This has led to algal blooms in the pond which periodically reduce the amount of dissolved oxygen available in the water. What will be the most likely long-term effect on the fish population living in the pond if the situation with the fertilizer does not change?

The fish population will grow as more offspring are born that can take advantage of the new conditions.
The population will be replaced by a different species of fish that consumes algae for food.
The fish population will learn to survive with less oxygen and more algae in the water.
The population will evolve, leaving only those genetically equipped to deal with low oxygen levels.

ansver
Answers: 3

Another question on Biology

question
Biology, 22.06.2019 00:00
As a small change in a person's dna can cause a genetic disorder
Answers: 1
question
Biology, 22.06.2019 10:00
Asegment of dna that codes for rna and a protein is a
Answers: 3
question
Biology, 22.06.2019 12:00
Due i have no idea on this brainliest to the best answer. case #28104 last month, hudson national bank was robbed by an unidentified man. the robber wore gloves, a hat, and a bandana that covered his face. a security guard attempting to stop the robber was knocked unconscious in a struggle. however, the guard managed to pull the hat from the robber's head. witness accounts and security tapes led police to arrest three possible suspects. none of the suspects have alibis, but police are not certain which man is the robber. using hair samples from the hat recovered by the security guard, the crime lab did a southern blot test. hair samples were also taken from each suspect. use the suspects' hair samples to determine the guilty party. suspect a tccatcca / tccatccatcca / tcca / ggcttacctataagg / tggatggatggatggatgga suspect b tccatcca / tccatccaattg / tcca / tccatccatccatccatcca / tggatggatggatgga suspect c ttagcta / ccggtatga / aggt / cgttatcggatata / ggttaggacctatcgataga probe aggt questions answer these following questions in the essay box below. a. which suspect most likely committed the robbery? b. how do you know?
Answers: 1
question
Biology, 22.06.2019 14:20
When a population split into two subgroups what is most likely to cause the subgroups to develop different traits?
Answers: 1
You know the right answer?
Houses have been built around a small retention pond, increasing the fertilizer runoff into the pond...
Questions
question
History, 04.02.2020 10:49
question
English, 04.02.2020 10:49
question
Mathematics, 04.02.2020 10:49
question
Chemistry, 04.02.2020 10:49
Questions on the website: 13722367