Darwin developed the theory of evolution. Which of these observation is the best evidence for the theory of evolution?
Humans have very diverse traits today.
There appear to be missing links in the evolutionary chain.
Life on earth has been found to date back billions of years.
D)
DNA found in older primate fossils resemble those of humans today
30)
According to Darwin's theory of evolution, which organisms are BEST able to survive in nature?
Answers: 2
Biology, 22.06.2019 04:00
Plsss > .< compare and contrast the characteristics of flatworms rounds worms and earthworms
Answers: 1
Biology, 22.06.2019 09:00
Suppose you could go back in time to interview henri becquerel on the day he discovered radioactivity. from his perspective, write an account of the discovery.
Answers: 2
Biology, 22.06.2019 11:00
1. which of the following transport mechanisms utilizes energy? a. osmosis b. diffusion c. facilitated diffusion d. endocytosis
Answers: 1
Biology, 22.06.2019 12:00
Due i have no idea on this brainliest to the best answer. case #28104 last month, hudson national bank was robbed by an unidentified man. the robber wore gloves, a hat, and a bandana that covered his face. a security guard attempting to stop the robber was knocked unconscious in a struggle. however, the guard managed to pull the hat from the robber's head. witness accounts and security tapes led police to arrest three possible suspects. none of the suspects have alibis, but police are not certain which man is the robber. using hair samples from the hat recovered by the security guard, the crime lab did a southern blot test. hair samples were also taken from each suspect. use the suspects' hair samples to determine the guilty party. suspect a tccatcca / tccatccatcca / tcca / ggcttacctataagg / tggatggatggatggatgga suspect b tccatcca / tccatccaattg / tcca / tccatccatccatccatcca / tggatggatggatgga suspect c ttagcta / ccggtatga / aggt / cgttatcggatata / ggttaggacctatcgataga probe aggt questions answer these following questions in the essay box below. a. which suspect most likely committed the robbery? b. how do you know?
Answers: 1
Darwin developed the theory of evolution. Which of these observation is the best evidence for the th...
Business, 02.11.2020 23:30
Mathematics, 02.11.2020 23:30
Mathematics, 02.11.2020 23:30
English, 02.11.2020 23:30
Mathematics, 02.11.2020 23:30
Chemistry, 02.11.2020 23:30
Chemistry, 02.11.2020 23:30
Biology, 02.11.2020 23:30
Geography, 02.11.2020 23:30
English, 02.11.2020 23:30
English, 02.11.2020 23:30
Computers and Technology, 02.11.2020 23:30