Biology, 16.04.2020 19:52 christhegreat1
Easy Gregor Mendel Questions / Will mark brainliest 50 Points ASAP
Who is known as the father of genetics?
Why use pea plants? (Why are pea plants an ideal genetic model?)
1. 2. 3.
What does it mean if something is true-breeding?
How did Mendel prevent the pea plants from self-pollinating?
Vocab:
Traits are:
Genes are:
Alleles are:
Hybrids
P F1 F2
What is the difference between a dominant and recessive allele?
If an organism has a dominant allele :
If an organism has a recessive allele :
What is the segregation principle?
When does segregation occur?
What is the difference between germ cells, and somatic cells?
What does probability have to do with genetics?
What is a 2-factor cross?
What is an Independent Assortment?
Exceptions to Mendel:
Incomplete dominance :
Codominance:
Multiple Alleles :
Polygenic Traits:
Answers: 2
Biology, 22.06.2019 08:30
What does polymerase chain reaction (pcr) do? o a. separates dna fragments by size o b. cuts a dna sample into fragments o c. provides an overall picture of a person's chromosomes o d. makes more copies of a sample of dna
Answers: 2
Biology, 22.06.2019 09:30
2. does the given statement describe a step in the transformation of the graph off(x) = x2 that would result in the graph of g(x) = -5x + 2)? a. the parent function is reflected across the x-axis. o yes nob. the parent function is stretched by a factor of 5. yes noonc. the parent function is translated 2 units up.o yes
Answers: 2
Biology, 22.06.2019 12:00
Due i have no idea on this brainliest to the best answer. case #28104 last month, hudson national bank was robbed by an unidentified man. the robber wore gloves, a hat, and a bandana that covered his face. a security guard attempting to stop the robber was knocked unconscious in a struggle. however, the guard managed to pull the hat from the robber's head. witness accounts and security tapes led police to arrest three possible suspects. none of the suspects have alibis, but police are not certain which man is the robber. using hair samples from the hat recovered by the security guard, the crime lab did a southern blot test. hair samples were also taken from each suspect. use the suspects' hair samples to determine the guilty party. suspect a tccatcca / tccatccatcca / tcca / ggcttacctataagg / tggatggatggatggatgga suspect b tccatcca / tccatccaattg / tcca / tccatccatccatccatcca / tggatggatggatgga suspect c ttagcta / ccggtatga / aggt / cgttatcggatata / ggttaggacctatcgataga probe aggt questions answer these following questions in the essay box below. a. which suspect most likely committed the robbery? b. how do you know?
Answers: 1
Easy Gregor Mendel Questions / Will mark brainliest 50 Points ASAP
Who is known as the f...
Who is known as the f...
Arts, 07.06.2020 05:58
Mathematics, 07.06.2020 05:58
Mathematics, 07.06.2020 05:58
Chemistry, 07.06.2020 05:58
English, 07.06.2020 05:58
Mathematics, 07.06.2020 05:58
Mathematics, 07.06.2020 05:58
Biology, 07.06.2020 05:58
English, 07.06.2020 05:58
Health, 07.06.2020 05:58