subject
Biology, 16.04.2020 23:14 cpcoolestkid4

You perform Sanger sequencing on a small fragment of the human genome and obtain the following small sequence read: 5' AGGCTTAAGCTTAATCGGGCTAT 3'. In order to determine if this sequence might be within the coding region of a gene, you examine it for open reading frames. How many open reading frames exist that go all the way through this DNA fragment? (Recall that the stop codons are 5' TAA, 5' TAG, and 5' TGA.)

ansver
Answers: 3

Another question on Biology

question
Biology, 22.06.2019 00:00
Which of the following is a consequence of urban heat islands? increased precipitation downwind of the city? increased precipitation upwind of the city? decreased winds within the city? increased winds within the city?
Answers: 1
question
Biology, 22.06.2019 00:40
As the human population grows, what happens to our natural-resource requirements? o they increase o they decrease o they do not change. they go in cycles
Answers: 2
question
Biology, 22.06.2019 02:30
Suppose you have monohybrid pea plants in your garden and find that they produce round seed to wrinkled seeds in the ratio of 3: 1. if the allele are designated (r & r) receptively. what is the probable genotypes of the round seeds which produced f 1 ? rr & rr rr only rr & rr rr only rr only
Answers: 1
question
Biology, 22.06.2019 09:00
The spermists believed that: the male made the only hereditary contribution to the offspring the male and female traits were blended in the offspring the female made the only hereditary contribution to the offspring the male and the female made equal contributions to the next generation
Answers: 1
You know the right answer?
You perform Sanger sequencing on a small fragment of the human genome and obtain the following small...
Questions
question
Mathematics, 20.07.2019 02:30
Questions on the website: 13722367