Answers: 1
Biology, 22.06.2019 06:50
The kidney filters potentially toxic substances in the blood, and thus βclearsβ the blood of those substances. this clearance function is dependent upon and proportional to the diffusion gradient of the substance across filtering capillaries, i.e. if the concentration of the substance is doubled, twice as much will be cleared from each ml of blood that is filtered. suppose that the body produces a constant amount of a substance x per unit of time. the kidneys eliminate substance x at a rate directly proportional to the concentration of the substance and the volume of blood cleared each minute (c): elimination = c Γ [x], where [x] is the steady-state concentration of substance x. imagine an individual with an initial concentration of x equal to [x]0 who develops kidney disease. her baseline clearance c0 drops to one half of the original (Β½c0). what is the new steady state concentration of x? (for simplicity, assume that substance x is 100% filtered by the kidney).
Answers: 1
Biology, 22.06.2019 12:00
Due i have no idea on this brainliest to the best answer. case #28104 last month, hudson national bank was robbed by an unidentified man. the robber wore gloves, a hat, and a bandana that covered his face. a security guard attempting to stop the robber was knocked unconscious in a struggle. however, the guard managed to pull the hat from the robber's head. witness accounts and security tapes led police to arrest three possible suspects. none of the suspects have alibis, but police are not certain which man is the robber. using hair samples from the hat recovered by the security guard, the crime lab did a southern blot test. hair samples were also taken from each suspect. use the suspects' hair samples to determine the guilty party. suspect a tccatcca / tccatccatcca / tcca / ggcttacctataagg / tggatggatggatggatgga suspect b tccatcca / tccatccaattg / tcca / tccatccatccatccatcca / tggatggatggatgga suspect c ttagcta / ccggtatga / aggt / cgttatcggatata / ggttaggacctatcgataga probe aggt questions answer these following questions in the essay box below. a. which suspect most likely committed the robbery? b. how do you know?
Answers: 1
Biology, 22.06.2019 13:00
This rapid change in species that rarely leaves behind fossil evidence is referred to as
Answers: 3
Biology, 22.06.2019 13:10
Which of the following is caused by reproductive isolation within a species? a. a decrease in gene flow b. an increase in genetic flow c. a decrease in genetic drift d. an increase in gene flow
Answers: 2
Are salmon considered unclean ?...
Mathematics, 04.03.2020 00:07
Chemistry, 04.03.2020 00:07
History, 04.03.2020 00:07
History, 04.03.2020 00:07
Mathematics, 04.03.2020 00:07
Computers and Technology, 04.03.2020 00:08
Computers and Technology, 04.03.2020 00:08