![subject](/tpl/images/cats/biologiya.png)
Below is the final functional kappa light-chain protein produced from germline DNA for the kappa light-chain in humans in a mature B-cell. V2 J3 C Below is a portion of the germline DNA for the kappa light-chain in humans. The intervening sequence is denoted by a horizontal line. For each step in the process of generating the above light-chain protein from the germline DNA below, determine if the corresponding DNA or RNA sequences would be present or absent in mature B-cell DNA, pre-mRNA, and mRNA.
![ansver](/tpl/images/cats/User.png)
Answers: 1
![](/tpl/images/ask_question.png)
![](/tpl/images/ask_question_mob.png)
Another question on Biology
![question](/tpl/images/cats/biologiya.png)
Biology, 22.06.2019 12:00
Due i have no idea on this brainliest to the best answer. case #28104 last month, hudson national bank was robbed by an unidentified man. the robber wore gloves, a hat, and a bandana that covered his face. a security guard attempting to stop the robber was knocked unconscious in a struggle. however, the guard managed to pull the hat from the robber's head. witness accounts and security tapes led police to arrest three possible suspects. none of the suspects have alibis, but police are not certain which man is the robber. using hair samples from the hat recovered by the security guard, the crime lab did a southern blot test. hair samples were also taken from each suspect. use the suspects' hair samples to determine the guilty party. suspect a tccatcca / tccatccatcca / tcca / ggcttacctataagg / tggatggatggatggatgga suspect b tccatcca / tccatccaattg / tcca / tccatccatccatccatcca / tggatggatggatgga suspect c ttagcta / ccggtatga / aggt / cgttatcggatata / ggttaggacctatcgataga probe aggt questions answer these following questions in the essay box below. a. which suspect most likely committed the robbery? b. how do you know?
Answers: 1
![question](/tpl/images/cats/biologiya.png)
Biology, 22.06.2019 14:30
What happens when a plant is losing too much water through transpiration? question 14 options: stomata open stomata close guard cells swell respiration increases
Answers: 1
![question](/tpl/images/cats/biologiya.png)
Biology, 22.06.2019 15:30
Wich is not standing in the way of astronomers getting a good view of different star
Answers: 2
![question](/tpl/images/cats/biologiya.png)
Biology, 22.06.2019 18:00
How did the work of farmers and breeders in england influence the work of charles darwin
Answers: 1
You know the right answer?
Below is the final functional kappa light-chain protein produced from germline DNA for the kappa lig...
Questions
![question](/tpl/images/cats/biologiya.png)
Biology, 27.08.2019 09:10
![question](/tpl/images/cats/istoriya.png)
![question](/tpl/images/cats/en.png)
![question](/tpl/images/cats/health.png)
Health, 27.08.2019 09:10
![question](/tpl/images/cats/fizika.png)
![question](/tpl/images/cats/en.png)
![question](/tpl/images/cats/mat.png)
![question](/tpl/images/cats/biologiya.png)
![question](/tpl/images/cats/istoriya.png)
![question](/tpl/images/cats/mat.png)
Mathematics, 27.08.2019 09:10
![question](/tpl/images/cats/obshestvoznanie.png)
Social Studies, 27.08.2019 09:10
![question](/tpl/images/cats/mat.png)
Mathematics, 27.08.2019 09:10
![question](/tpl/images/cats/istoriya.png)
![question](/tpl/images/cats/ekonomika.png)
![question](/tpl/images/cats/mkx.png)
![question](/tpl/images/cats/biologiya.png)
Biology, 27.08.2019 09:10
![question](/tpl/images/cats/mkx.png)
Arts, 27.08.2019 09:10
![question](/tpl/images/cats/mat.png)
Mathematics, 27.08.2019 09:10
![question](/tpl/images/cats/mat.png)
Mathematics, 27.08.2019 09:10
![question](/tpl/images/cats/health.png)
Health, 27.08.2019 09:10