Grade 8 ohio science fusion unit 6 lesson 3 review page 373 answer key

This class has taught you that the use of science and medicine in practical ways has become an international endeavor. one of the greatest examples of an international science accomplishment is which allows the profiling of human dna, useful not only to science but also medicine. a) forensic science b) the fbi c) the human genome project d) bioterrorism

Which is not a characteristic of bacteria? a. they are unicellular. b. they are prokaryotic. c. they are the smallest form of life on earth. d. they are multicellular.

Due i have no idea on this brainliest to the best answer. case #28104 last month, hudson national bank was robbed by an unidentified man. the robber wore gloves, a hat, and a bandana that covered his face. a security guard attempting to stop the robber was knocked unconscious in a struggle. however, the guard managed to pull the hat from the robber's head. witness accounts and security tapes led police to arrest three possible suspects. none of the suspects have alibis, but police are not certain which man is the robber. using hair samples from the hat recovered by the security guard, the crime lab did a southern blot test. hair samples were also taken from each suspect. use the suspects' hair samples to determine the guilty party. suspect a tccatcca / tccatccatcca / tcca / ggcttacctataagg / tggatggatggatggatgga suspect b tccatcca / tccatccaattg / tcca / tccatccatccatccatcca / tggatggatggatgga suspect c ttagcta / ccggtatga / aggt / cgttatcggatata / ggttaggacctatcgataga probe aggt questions answer these following questions in the essay box below. a. which suspect most likely committed the robbery? b. how do you know?