Answers: 1
Biology, 22.06.2019 06:00
Sarah and john are having a discussion on genetic diversity. sarah believes that it happen over a long period of time. john it happens immediately. who is correct? a. sarah is correct because genetic diversity occurs over a long period of time. b. john is correct because genetic diversity occurs immediately. c. both are correct because genetic variation can occur or long period of time. d. neither are correct because genetic diversity occurs over any period of time
Answers: 1
Biology, 22.06.2019 12:00
Due i have no idea on this brainliest to the best answer. case #28104 last month, hudson national bank was robbed by an unidentified man. the robber wore gloves, a hat, and a bandana that covered his face. a security guard attempting to stop the robber was knocked unconscious in a struggle. however, the guard managed to pull the hat from the robber's head. witness accounts and security tapes led police to arrest three possible suspects. none of the suspects have alibis, but police are not certain which man is the robber. using hair samples from the hat recovered by the security guard, the crime lab did a southern blot test. hair samples were also taken from each suspect. use the suspects' hair samples to determine the guilty party. suspect a tccatcca / tccatccatcca / tcca / ggcttacctataagg / tggatggatggatggatgga suspect b tccatcca / tccatccaattg / tcca / tccatccatccatccatcca / tggatggatggatgga suspect c ttagcta / ccggtatga / aggt / cgttatcggatata / ggttaggacctatcgataga probe aggt questions answer these following questions in the essay box below. a. which suspect most likely committed the robbery? b. how do you know?
Answers: 1
Biology, 22.06.2019 15:20
Suppose a particular species of tulip plant has three alleles for the gene that codes for flower color. the cr allele produces red tulips, the cp allele produces purple tulips, and the cw allele produces white tulips. cr is dominant over cp and cw, and cp is dominant over cw. for each of the following crosses, determine the expected ratio of offspring for each flower color. cr cp x cp cw cr cw x cp cw 1 red: 1 purple : 0 white, 1 red: 2 purple: 1 white, 2 red: 1 purple 1 white, 1 red: 3 purple : 0 white, 2 red: 0 purple : 2 white, 2 red: 2 purple : 0 white
Answers: 2
Describe the action of the tricuspid valve when you squeezed the water-filled right ventricle...
Social Studies, 20.07.2019 13:50
History, 20.07.2019 13:50
History, 20.07.2019 13:50
Business, 20.07.2019 13:50
Social Studies, 20.07.2019 13:50
History, 20.07.2019 13:50
History, 20.07.2019 13:50
Physics, 20.07.2019 13:50
History, 20.07.2019 13:50