Biology, 23.04.2020 19:18 kimloveswim
The following information applies to the next 2 problems. Shape in radishes is controlled by a locus with two co-dominant alleles, L is long and L' is round. Combinations of these alleles produce the following phenotypes: LL is long, LL' is oval, L'L' is round. Color in radishes is controlled by another locus on a different pair of chromosomes which has two co-dominant alleles: R is red and R' is white. Combinations of these alleles produce the following phenotypes: RR is red, RR' is purple, R'R' is white. There is a mating between a long, purple plant and a round, red plant. What is the probability (fraction of the offspring) that an offspring will be oval, purple?
a. 1/2
b. 14
c. 3/4
d. 3/8
e. none of these
Answers: 3
Biology, 22.06.2019 12:00
Due i have no idea on this brainliest to the best answer. case #28104 last month, hudson national bank was robbed by an unidentified man. the robber wore gloves, a hat, and a bandana that covered his face. a security guard attempting to stop the robber was knocked unconscious in a struggle. however, the guard managed to pull the hat from the robber's head. witness accounts and security tapes led police to arrest three possible suspects. none of the suspects have alibis, but police are not certain which man is the robber. using hair samples from the hat recovered by the security guard, the crime lab did a southern blot test. hair samples were also taken from each suspect. use the suspects' hair samples to determine the guilty party. suspect a tccatcca / tccatccatcca / tcca / ggcttacctataagg / tggatggatggatggatgga suspect b tccatcca / tccatccaattg / tcca / tccatccatccatccatcca / tggatggatggatgga suspect c ttagcta / ccggtatga / aggt / cgttatcggatata / ggttaggacctatcgataga probe aggt questions answer these following questions in the essay box below. a. which suspect most likely committed the robbery? b. how do you know?
Answers: 1
Biology, 22.06.2019 13:00
"your temperature analysis reveals a pattern with coldest temperatures located to the portion of the map."
Answers: 1
Biology, 22.06.2019 21:00
What is the difference between hypothesis, theories, laws, and observations?
Answers: 1
Biology, 22.06.2019 21:00
Me what would happen if a plant could carry out photosynthesis, but not respiration? question 1 options: it would have no food. it would have too much water. it would be unable to capture the energy in sunlight. it could make food but not break it down for energy.
Answers: 1
The following information applies to the next 2 problems. Shape in radishes is controlled by a locus...
History, 12.10.2020 02:01
Mathematics, 12.10.2020 02:01
Mathematics, 12.10.2020 02:01
Mathematics, 12.10.2020 02:01
Mathematics, 12.10.2020 02:01
Social Studies, 12.10.2020 02:01
Mathematics, 12.10.2020 02:01
Chemistry, 12.10.2020 02:01
Physics, 12.10.2020 02:01
Mathematics, 12.10.2020 02:01
Mathematics, 12.10.2020 02:01
Physics, 12.10.2020 02:01