The lagging strand is characterized by a series of short segments of DNA (Okazaki fragments) that will be joined together to form a finished lagging strand. The experiments that led to the discovery of Okazaki fragments gave evidence for which ideas?

Due i have no idea on this brainliest to the best answer. case #28104 last month, hudson national bank was robbed by an unidentified man. the robber wore gloves, a hat, and a bandana that covered his face. a security guard attempting to stop the robber was knocked unconscious in a struggle. however, the guard managed to pull the hat from the robber's head. witness accounts and security tapes led police to arrest three possible suspects. none of the suspects have alibis, but police are not certain which man is the robber. using hair samples from the hat recovered by the security guard, the crime lab did a southern blot test. hair samples were also taken from each suspect. use the suspects' hair samples to determine the guilty party. suspect a tccatcca / tccatccatcca / tcca / ggcttacctataagg / tggatggatggatggatgga suspect b tccatcca / tccatccaattg / tcca / tccatccatccatccatcca / tggatggatggatgga suspect c ttagcta / ccggtatga / aggt / cgttatcggatata / ggttaggacctatcgataga probe aggt questions answer these following questions in the essay box below. a. which suspect most likely committed the robbery? b. how do you know?

Ascientist is investigating the effects of salinity on fish development. he places fertilized fish eggs in an aquarium that contains low salinity and observes their development. what factor would improve experimental design the most? place the fish eggs in the open ocean because that is the natural habitat include another aquarium that has normal salinity to compare to the low salinity aquarium include an aquarium that replaces salt with sugar to confirm that the effects are specific to salt grow algae with the fish eggs in order to provide adequate nutrients to the developing embryos

Ascientist discovers a new body between the orbit of neptune and the kuiper belt. the object is round and travels in an orbit around neptune with other space objects. the scientist claims that she has found a new dwarf planet. where is the scientist’s error? the object is an asteroid, not a dwarf planet.the object is a moon, not a dwarf planet.the object is not a dwarf planet because it travels with other objects.the object is not a dwarf planet because it is round.