subject
Biology, 05.05.2020 18:03 Jinesha

If you play a low note on an instrument, you know that the sound wave has what?

ansver
Answers: 3

Another question on Biology

question
Biology, 21.06.2019 20:00
Common commercial benefits of microorganisms include synthesis ofa. insulin.b. antibiotics.c. aspirin.d. antibiotics and aspirin.e. antibiotics and insulin.
Answers: 1
question
Biology, 22.06.2019 07:10
He did not infringe upon the policy making powers that he felt the constitution gave congress. but the determination of foreign policy became preponderantly a presidential concern. when the french revolution led to a major war between france and england, washington refused to accept entirely the recommendations of either his secretary of state thomas jefferson, who was pro-french, or his secretary of the treasury alexander hamilton, who was pro-british. rather, he insisted upon a neutral course until the united states could grow stronger. which provides the best objective summary of this excerpt? president washington made a good choice when he decided not to accept the recommendations of his advisors and instead insisted that the united states stay neutral during the war between france and england as president, washington believed that the united states should remain neutral in foreign policy even though he had advisors who recommended that he take sides during the war between france and england. washington did not make policy decisions during his presidency because he did not want to interfere with the policy-making powers that the constitution gave congress. washington refused to accept entirely the recommendations of either his secretary of state thomas jefferson, who was pro-french, or his secretary of the treasury alexander hamilton, who was pro-britis
Answers: 3
question
Biology, 22.06.2019 10:30
Which of the following statements is accurate about evolution? question 10 options: natural selection only eliminates odd individuals. evolution means that a population never has changes in its genetic frequencies. mutations are always harmful. evolution means that a population undergoes changes in its gene frequencies over time.
Answers: 1
question
Biology, 22.06.2019 12:00
Due i have no idea on this brainliest to the best answer. case #28104 last month, hudson national bank was robbed by an unidentified man. the robber wore gloves, a hat, and a bandana that covered his face. a security guard attempting to stop the robber was knocked unconscious in a struggle. however, the guard managed to pull the hat from the robber's head. witness accounts and security tapes led police to arrest three possible suspects. none of the suspects have alibis, but police are not certain which man is the robber. using hair samples from the hat recovered by the security guard, the crime lab did a southern blot test. hair samples were also taken from each suspect. use the suspects' hair samples to determine the guilty party. suspect a tccatcca / tccatccatcca / tcca / ggcttacctataagg / tggatggatggatggatgga suspect b tccatcca / tccatccaattg / tcca / tccatccatccatccatcca / tggatggatggatgga suspect c ttagcta / ccggtatga / aggt / cgttatcggatata / ggttaggacctatcgataga probe aggt questions answer these following questions in the essay box below. a. which suspect most likely committed the robbery? b. how do you know?
Answers: 1
You know the right answer?
If you play a low note on an instrument, you know that the sound wave has what?...
Questions
question
Mathematics, 09.10.2021 23:30
question
English, 09.10.2021 23:30
question
Mathematics, 09.10.2021 23:40
question
Chemistry, 09.10.2021 23:40
Questions on the website: 13722359