What do scientists think was the first rna that led to life

In pea plants, yellow seed color (y) is dominant and green seed color (y) is recessive. based on the punnett squares, what are the chances that the offspring in the second generation will have green seeds?

Due i have no idea on this brainliest to the best answer. case #28104 last month, hudson national bank was robbed by an unidentified man. the robber wore gloves, a hat, and a bandana that covered his face. a security guard attempting to stop the robber was knocked unconscious in a struggle. however, the guard managed to pull the hat from the robber's head. witness accounts and security tapes led police to arrest three possible suspects. none of the suspects have alibis, but police are not certain which man is the robber. using hair samples from the hat recovered by the security guard, the crime lab did a southern blot test. hair samples were also taken from each suspect. use the suspects' hair samples to determine the guilty party. suspect a tccatcca / tccatccatcca / tcca / ggcttacctataagg / tggatggatggatggatgga suspect b tccatcca / tccatccaattg / tcca / tccatccatccatccatcca / tggatggatggatgga suspect c ttagcta / ccggtatga / aggt / cgttatcggatata / ggttaggacctatcgataga probe aggt questions answer these following questions in the essay box below. a. which suspect most likely committed the robbery? b. how do you know?

Which statement about relative potential energy of electrons is correct? a. an electron in the 2 p orbital of the second electron shell has more potential energy than an electron in the 2 s orbital of the second electron shell. b. an electron in the 2 p orbital of the second electron shell has more potential energy than an electron in the 3 p orbital of the third electron shell. c. an electron in the 3 p orbital of the third electron shell has more potential energy than an electron in the 2 p orbital of the second electron shell.