The middle of an mRNA molecule contains the nucleotide sequence shown here. Much more of the mRNA is translated. Assume that the sequence is read from left to right.

AUUUAACUGUUCUGUCUAGAG

1. Use the genetic code to translate the sequence into each of the three possible sets of amino acids.

2. Which of the three sets of amino acids is the most likely to be included in the polypeptide? Explain your reasoning.

According to your text, should be in the native language of the parents or guardians whenever possible. a. an email b. consent forms c. oral approval d. storybooks loaned out

The graph shows how much money the south dakota livestock industry earns annually. according to the graph, which industry would experience the greatest financial impact from a loss of pastureland

18. determine whether each stateme blank space given. ach statement is true (t) or false (f). place your answer in the 8. when a cell is put into an isotonic solution, individual wat put into an isotonic solution, individual water molecules cannot move back and forth across the cell membrane. d. when a cell is put into a hypertonic solution, there is a net movement of water molecules across the cell membrane into the cell. c. when a cell is put into a hypotonic solution, there is a net movement of water molecules across the cell membrane out of the cell. d. the movement of any solvent across a semi-permeable membrane is called osmosis. e. carrier proteins have the ability to change shape and physically move molecules across the cell membrane. f. in facilitated diffusion, the concentration of the molecules to be moved across the cell membrane is higher inside the cell.