Human lizard
at
whale
bat
frog
bird
humerush
ulna
ra...
![subject](/tpl/images/cats/biologiya.png)
Human lizard
at
whale
bat
frog
bird
humerush
ulna
radius
N
carpal
5432
1. Using the figure above explain what homologous structures are. Specifically explain how
homologous structures are used as a source of evidence to infer evolutionary relationships
I between modern and fossil organisms. You may cite evidence from other lessons to construct
your explanation
![ansver](/tpl/images/cats/User.png)
Answers: 3
![](/tpl/images/ask_question.png)
![](/tpl/images/ask_question_mob.png)
Another question on Biology
![question](/tpl/images/cats/biologiya.png)
Biology, 22.06.2019 12:00
Due i have no idea on this brainliest to the best answer. case #28104 last month, hudson national bank was robbed by an unidentified man. the robber wore gloves, a hat, and a bandana that covered his face. a security guard attempting to stop the robber was knocked unconscious in a struggle. however, the guard managed to pull the hat from the robber's head. witness accounts and security tapes led police to arrest three possible suspects. none of the suspects have alibis, but police are not certain which man is the robber. using hair samples from the hat recovered by the security guard, the crime lab did a southern blot test. hair samples were also taken from each suspect. use the suspects' hair samples to determine the guilty party. suspect a tccatcca / tccatccatcca / tcca / ggcttacctataagg / tggatggatggatggatgga suspect b tccatcca / tccatccaattg / tcca / tccatccatccatccatcca / tggatggatggatgga suspect c ttagcta / ccggtatga / aggt / cgttatcggatata / ggttaggacctatcgataga probe aggt questions answer these following questions in the essay box below. a. which suspect most likely committed the robbery? b. how do you know?
Answers: 1
![question](/tpl/images/cats/biologiya.png)
Biology, 22.06.2019 12:40
Which statement describes how favorable traits in a population relate to natural selection? they are the only traits that ever exist in the population. they build in the population over time. they are rarely passed on to offspring. they are found only in a few individuals within the population.
Answers: 1
![question](/tpl/images/cats/biologiya.png)
Biology, 22.06.2019 13:50
The largest unit within which gene flow can readily occur is a
Answers: 3
![question](/tpl/images/cats/biologiya.png)
Biology, 22.06.2019 21:00
Some steps in cell division are shown below: 1. chromosomes condense and pair up 2. segments of dna of sister chromatids twist and cross 3. exchange of dna occurs between chromosomes 4. four daughter cells are created that are haploid which of the following steps is least likely to occur during meiosis 1?
Answers: 1
You know the right answer?
Questions
![question](/tpl/images/cats/istoriya.png)
![question](/tpl/images/cats/obshestvoznanie.png)
Social Studies, 14.12.2020 19:40
![question](/tpl/images/cats/istoriya.png)
![question](/tpl/images/cats/mat.png)
Mathematics, 14.12.2020 19:40
![question](/tpl/images/cats/istoriya.png)
![question](/tpl/images/cats/en.png)
English, 14.12.2020 19:40
![question](/tpl/images/cats/biologiya.png)
![question](/tpl/images/cats/mat.png)
Mathematics, 14.12.2020 19:40
![question](/tpl/images/cats/en.png)
![question](/tpl/images/cats/biologiya.png)
Biology, 14.12.2020 19:40
![question](/tpl/images/cats/himiya.png)
![question](/tpl/images/cats/en.png)
![question](/tpl/images/cats/mat.png)
Mathematics, 14.12.2020 19:40
![question](/tpl/images/cats/istoriya.png)
![question](/tpl/images/cats/en.png)
![question](/tpl/images/cats/mat.png)
Mathematics, 14.12.2020 19:40
![question](/tpl/images/cats/mat.png)
Mathematics, 14.12.2020 19:40
![question](/tpl/images/cats/istoriya.png)
![question](/tpl/images/cats/biologiya.png)