subject
Biology, 19.05.2020 15:17 angeladominguezgarci

In mice, fur color is a genetically determined trait. To observe the effects of natural selection on fur color in mice, scientists set up six enclosures with either light- or dark-colored sand on the ground. The enclosures were isolated from all ground predators and wild mice but accessible to predatory birds. The scientists placed equal numbers of light- and dark-colored mice into each enclosure. A total of 500 mice were used in the experiment. After several generations, the scientists sampled the mice and found that populations in the light sand enclosures were, on average, lighter in color than the original population, while those in the dark sand enclosures were, on average, darker in color than the mice in the original population.

a) describe the way the scientists will determine the evolutionary fitness of the mice in the experiment.

b) Identify the independent variable in the scientists’ experiment.

c) State the null hypothesis

d) The scientists claim that the changes in the frequency of fur color were the result of natural selection. Justify their prediction.

ansver
Answers: 1

Another question on Biology

question
Biology, 22.06.2019 04:20
Hybrid instruments that play sounds that are part sampled and part synthesized are known as:
Answers: 1
question
Biology, 22.06.2019 05:30
Where can dna be found in a prokaryotic cell
Answers: 2
question
Biology, 22.06.2019 09:00
The current thought on the structure of the cell membrane is: a. a static phosphate sandwich of lipids b. a fluid-mosaic of phospholipids and proteins c. a bilayer of proteins with static lipid molecules d. an impermeable bilayer of protein molecules e. a static and permeable phospholipid single layer
Answers: 2
question
Biology, 22.06.2019 12:00
Due i have no idea on this brainliest to the best answer. case #28104 last month, hudson national bank was robbed by an unidentified man. the robber wore gloves, a hat, and a bandana that covered his face. a security guard attempting to stop the robber was knocked unconscious in a struggle. however, the guard managed to pull the hat from the robber's head. witness accounts and security tapes led police to arrest three possible suspects. none of the suspects have alibis, but police are not certain which man is the robber. using hair samples from the hat recovered by the security guard, the crime lab did a southern blot test. hair samples were also taken from each suspect. use the suspects' hair samples to determine the guilty party. suspect a tccatcca / tccatccatcca / tcca / ggcttacctataagg / tggatggatggatggatgga suspect b tccatcca / tccatccaattg / tcca / tccatccatccatccatcca / tggatggatggatgga suspect c ttagcta / ccggtatga / aggt / cgttatcggatata / ggttaggacctatcgataga probe aggt questions answer these following questions in the essay box below. a. which suspect most likely committed the robbery? b. how do you know?
Answers: 1
You know the right answer?
In mice, fur color is a genetically determined trait. To observe the effects of natural selection on...
Questions
question
Mathematics, 09.04.2021 05:00
question
Chemistry, 09.04.2021 05:00
question
Mathematics, 09.04.2021 05:00
question
English, 09.04.2021 05:00
Questions on the website: 13722363