Biology, 21.05.2020 00:09 mahin3545

Which factor would scientists most likely evaluate to determine the health of a marine ecosystem?

Frequency of predation
Levels of pollution
Particulates in the air
Reproductive success of consumers

Answers: 2

Show answers

Another question on Biology

Biology, 21.06.2019 20:00

The images show the wings of a bat and a bee. from this evidence, what can you conclude about the evolutionary relationship between these organisms? a. the wing structures of the bat and the bee are different, indicating they didn’t inherit wings from a common ancestor. b. the wing structures of the bat and the bee are different, indicating they inherited wings from a common ancestor. c. the functions of bat wings and bee wings are the same, indicating they obtained wings from a common ancestor. d. the functions of bat wings and bee wings are different, indicating they didn’t obtain wings from a common ancestor.

Answers: 3

Answer

Biology, 22.06.2019 07:00

Which of the following will a bacterium produce when a human gene is added to its genome? question 4 options: human carbohydrates a protein made up of both human and bacterial properties the human protein coded for by the human gene human plasmids that can be isolated from the bacterium

Answers: 2

Answer

Biology, 22.06.2019 11:10

Which of these statements is true about autotrophs, but not heterotrophs? a. they use sugar and oxygen to make carbon dioxide and water.b. they use chlorophyll and oxygen to make carbon dioxide and water.c. they use sunlight, water, and carbon dioxide to make sugars.d. they use sunlight, water, and oxygen to make chlorophyll.

Answers: 1

Answer

Biology, 22.06.2019 12:00

Due i have no idea on this brainliest to the best answer. case #28104 last month, hudson national bank was robbed by an unidentified man. the robber wore gloves, a hat, and a bandana that covered his face. a security guard attempting to stop the robber was knocked unconscious in a struggle. however, the guard managed to pull the hat from the robber's head. witness accounts and security tapes led police to arrest three possible suspects. none of the suspects have alibis, but police are not certain which man is the robber. using hair samples from the hat recovered by the security guard, the crime lab did a southern blot test. hair samples were also taken from each suspect. use the suspects' hair samples to determine the guilty party. suspect a tccatcca / tccatccatcca / tcca / ggcttacctataagg / tggatggatggatggatgga suspect b tccatcca / tccatccaattg / tcca / tccatccatccatccatcca / tggatggatggatgga suspect c ttagcta / ccggtatga / aggt / cgttatcggatata / ggttaggacctatcgataga probe aggt questions answer these following questions in the essay box below. a. which suspect most likely committed the robbery? b. how do you know?

Answers: 1

Answer

You know the right answer?

Which factor would scientists most likely evaluate to determine the health of a marine ecosystem?

Questions