![ansver](/tpl/images/cats/User.png)
Answers: 2
![](/tpl/images/ask_question.png)
![](/tpl/images/ask_question_mob.png)
Another question on Biology
![question](/tpl/images/cats/biologiya.png)
Biology, 21.06.2019 15:00
Which class of molecules contains the amino group, nh2 (a) sugars (b) water (c) proteins (d) hydrocarbons
Answers: 1
![question](/tpl/images/cats/biologiya.png)
Biology, 22.06.2019 11:10
Look at the photo of the leaf, which term best describes this leaf ? a-simple.b-parallel.c-lobed.d-tooth.
Answers: 2
![question](/tpl/images/cats/biologiya.png)
Biology, 22.06.2019 12:00
Due i have no idea on this brainliest to the best answer. case #28104 last month, hudson national bank was robbed by an unidentified man. the robber wore gloves, a hat, and a bandana that covered his face. a security guard attempting to stop the robber was knocked unconscious in a struggle. however, the guard managed to pull the hat from the robber's head. witness accounts and security tapes led police to arrest three possible suspects. none of the suspects have alibis, but police are not certain which man is the robber. using hair samples from the hat recovered by the security guard, the crime lab did a southern blot test. hair samples were also taken from each suspect. use the suspects' hair samples to determine the guilty party. suspect a tccatcca / tccatccatcca / tcca / ggcttacctataagg / tggatggatggatggatgga suspect b tccatcca / tccatccaattg / tcca / tccatccatccatccatcca / tggatggatggatgga suspect c ttagcta / ccggtatga / aggt / cgttatcggatata / ggttaggacctatcgataga probe aggt questions answer these following questions in the essay box below. a. which suspect most likely committed the robbery? b. how do you know?
Answers: 1
![question](/tpl/images/cats/biologiya.png)
Biology, 22.06.2019 12:30
Which of the following matches the organisms described with the correct domain? a. archaea--multicellular, eukaryotic organisms that do not have cell walls b. eukarya--single-celled and multicellular organisms, with a defined nucleus and a variety of nutritional sources c. bacteria--unicellular, eukaryotic organisms with cell walls that do not contain peptidoglycan d. bacteria--unicellular, eukaryotic organisms that always lack cell walls
Answers: 3
You know the right answer?
How does each gene code for a protein...
Questions
![question](/tpl/images/cats/mat.png)
![question](/tpl/images/cats/obshestvoznanie.png)
![question](/tpl/images/cats/mat.png)
Mathematics, 09.03.2021 20:00
![question](/tpl/images/cats/mat.png)
![question](/tpl/images/cats/mat.png)
Mathematics, 09.03.2021 20:00
![question](/tpl/images/cats/obshestvoznanie.png)
![question](/tpl/images/cats/mat.png)
![question](/tpl/images/cats/mat.png)
Mathematics, 09.03.2021 20:00
![question](/tpl/images/cats/en.png)
English, 09.03.2021 20:00
![question](/tpl/images/cats/himiya.png)
Chemistry, 09.03.2021 20:00
![question](/tpl/images/cats/himiya.png)
Chemistry, 09.03.2021 20:00
![question](/tpl/images/cats/mat.png)
![question](/tpl/images/cats/geografiya.png)
![question](/tpl/images/cats/fizika.png)
![question](/tpl/images/cats/istoriya.png)
History, 09.03.2021 20:00
![question](/tpl/images/cats/mat.png)
![question](/tpl/images/cats/mat.png)
Mathematics, 09.03.2021 20:00
![question](/tpl/images/cats/biologiya.png)
![question](/tpl/images/cats/mat.png)
Mathematics, 09.03.2021 20:00
![question](/tpl/images/cats/obshestvoznanie.png)
Social Studies, 09.03.2021 20:00