![subject](/tpl/images/cats/biologiya.png)
Biology, 22.05.2020 17:59 c1100321311
The central dogma of molecular biology describes the two-step process, transcription and translation, by which the information coded in DNA is used to make proteins or polypeptides. Using the model presented, what is represented by A? Defend your answer.. A) A represents RNA. Translation is the synthesis of an RNA copy of a segment of DNA. B) A represents RNA. Transcription is the synthesis of an RNA copy of a segment of DNA. C) A represents protein. Translation is the synthesis of a protein using DNA as a template for the assembly of the protein. D) A represents protein. Transcription is the synthesis of a protein using DNA as a template for the assembly of the protein.
![ansver](/tpl/images/cats/User.png)
Answers: 2
![](/tpl/images/ask_question.png)
![](/tpl/images/ask_question_mob.png)
Another question on Biology
![question](/tpl/images/cats/biologiya.png)
Biology, 22.06.2019 12:00
Due i have no idea on this brainliest to the best answer. case #28104 last month, hudson national bank was robbed by an unidentified man. the robber wore gloves, a hat, and a bandana that covered his face. a security guard attempting to stop the robber was knocked unconscious in a struggle. however, the guard managed to pull the hat from the robber's head. witness accounts and security tapes led police to arrest three possible suspects. none of the suspects have alibis, but police are not certain which man is the robber. using hair samples from the hat recovered by the security guard, the crime lab did a southern blot test. hair samples were also taken from each suspect. use the suspects' hair samples to determine the guilty party. suspect a tccatcca / tccatccatcca / tcca / ggcttacctataagg / tggatggatggatggatgga suspect b tccatcca / tccatccaattg / tcca / tccatccatccatccatcca / tggatggatggatgga suspect c ttagcta / ccggtatga / aggt / cgttatcggatata / ggttaggacctatcgataga probe aggt questions answer these following questions in the essay box below. a. which suspect most likely committed the robbery? b. how do you know?
Answers: 1
![question](/tpl/images/cats/biologiya.png)
Biology, 22.06.2019 17:30
98 points you will be galileo perform the experiment to determine if objects with different mass fall at the same, or different, rates in the air and in a vacuum. before you conduct your experiment, you need to form a hypothesis. a hypothesis is a prediction of what you think will happen in the experiment. the hypothesis is a statement that describes βifβ a certain set of circumstances are present βthenβ there will be a specific result that will occur. record your hypothesis here: record the results from step one of the experiment (dropping the objects in the air): first trial: second trial: third trial: record the results from step two of the experiment (dropping the objects in a vacuum): first trial: second trial: third trial: did the experiment support your hypothesis? using the data from your experiment, describe why you believe your hypothesis was either proven or disproven. what forces were acting on the objects dropped in the air? what force was acting on the objects dropped in the vacuum? part two: comparing forces choose two forces and compare and contrast these forces. you must provide two ways that they are alike and two ways that they are different. you may make a list, write in paragraph form, or make a chart. choose two forces and compare and contrast these forces. these must be different forces than used in the prior question. provide two ways that they are similar and two ways that they are different. you may make a list, write it out, or make a chart.
Answers: 1
![question](/tpl/images/cats/biologiya.png)
![question](/tpl/images/cats/biologiya.png)
Biology, 22.06.2019 18:30
Fungi exist as single cells or as branching networks of multicellular filaments. how does the structure of filaments relate to their function
Answers: 2
You know the right answer?
The central dogma of molecular biology describes the two-step process, transcription and translation...
Questions
![question](/tpl/images/cats/en.png)
English, 30.07.2019 22:00
![question](/tpl/images/cats/ekonomika.png)
Business, 30.07.2019 22:00
![question](/tpl/images/cats/istoriya.png)
History, 30.07.2019 22:00
![question](/tpl/images/cats/biologiya.png)
Biology, 30.07.2019 22:00
![question](/tpl/images/cats/en.png)
![question](/tpl/images/cats/geografiya.png)
Geography, 30.07.2019 22:00
![question](/tpl/images/cats/health.png)
![question](/tpl/images/cats/himiya.png)
![question](/tpl/images/cats/mat.png)
![question](/tpl/images/cats/istoriya.png)
![question](/tpl/images/cats/mat.png)
![question](/tpl/images/cats/biologiya.png)
![question](/tpl/images/cats/ekonomika.png)
![question](/tpl/images/cats/mat.png)
Mathematics, 30.07.2019 22:00
![question](/tpl/images/cats/mat.png)
![question](/tpl/images/cats/informatica.png)
Computers and Technology, 30.07.2019 22:00
![question](/tpl/images/cats/ekonomika.png)
Business, 30.07.2019 22:00
![question](/tpl/images/cats/fizika.png)
![question](/tpl/images/cats/himiya.png)
Chemistry, 30.07.2019 22:00