![subject](/tpl/images/cats/biologiya.png)
Biology, 21.05.2020 21:14 cjjjjjjjjjjjjj
A geologist studies a layered rock to determine its age. Bacterial fossils from Precambrian time are found in the rock’s upper layers, but no bacterial fossils are found in the rock’s bottom layers. Which of these conclusions about the fossils within the rock is best supported by the evidence?
A. The age of the entire rock is determined by the age of the bacterial fossils within it.
B. Most Precambrian organisms were too small to leave fossil remains so the age of the rock cannot be determined by examining this evidence.
C. Because bacterial fossils are found only in the upper layers, scientists can conclude that these bacteria evolved towards the end of Precambrian time.
D. The bacterial fossils must have been formed during a different time period because most of the rocks from the Precambrian have been destroyed due to tectonic activity.
![ansver](/tpl/images/cats/User.png)
Answers: 2
![](/tpl/images/ask_question.png)
![](/tpl/images/ask_question_mob.png)
Another question on Biology
![question](/tpl/images/cats/biologiya.png)
Biology, 21.06.2019 23:00
What are tissues? a groups of tissues that work together b basic units of structure and function c groups of cells that perform the same function d multiple organs that perform a major function
Answers: 2
![question](/tpl/images/cats/biologiya.png)
Biology, 22.06.2019 05:00
Aristotle classified animals according to their a. habitat and mating behavior c. mating behavior and relatedness b. habitat and physical differences d. physical differences and mating behavior
Answers: 1
![question](/tpl/images/cats/biologiya.png)
Biology, 22.06.2019 07:00
Give an example of a trait that is controlled by more than one gene.
Answers: 1
![question](/tpl/images/cats/biologiya.png)
Biology, 22.06.2019 12:00
Due i have no idea on this brainliest to the best answer. case #28104 last month, hudson national bank was robbed by an unidentified man. the robber wore gloves, a hat, and a bandana that covered his face. a security guard attempting to stop the robber was knocked unconscious in a struggle. however, the guard managed to pull the hat from the robber's head. witness accounts and security tapes led police to arrest three possible suspects. none of the suspects have alibis, but police are not certain which man is the robber. using hair samples from the hat recovered by the security guard, the crime lab did a southern blot test. hair samples were also taken from each suspect. use the suspects' hair samples to determine the guilty party. suspect a tccatcca / tccatccatcca / tcca / ggcttacctataagg / tggatggatggatggatgga suspect b tccatcca / tccatccaattg / tcca / tccatccatccatccatcca / tggatggatggatgga suspect c ttagcta / ccggtatga / aggt / cgttatcggatata / ggttaggacctatcgataga probe aggt questions answer these following questions in the essay box below. a. which suspect most likely committed the robbery? b. how do you know?
Answers: 1
You know the right answer?
A geologist studies a layered rock to determine its age. Bacterial fossils from Precambrian time are...
Questions
![question](/tpl/images/cats/mat.png)
Mathematics, 13.04.2021 09:10
![question](/tpl/images/cats/istoriya.png)
History, 13.04.2021 09:10
![question](/tpl/images/cats/fr.png)
![question](/tpl/images/cats/informatica.png)
Computers and Technology, 13.04.2021 09:10
![question](/tpl/images/cats/mat.png)
Mathematics, 13.04.2021 09:10
![question](/tpl/images/cats/mat.png)
Mathematics, 13.04.2021 09:10
![question](/tpl/images/cats/mat.png)
![question](/tpl/images/cats/mat.png)
Mathematics, 13.04.2021 09:10
![question](/tpl/images/cats/mat.png)
Mathematics, 13.04.2021 09:10
![question](/tpl/images/cats/mat.png)
Mathematics, 13.04.2021 09:10
![question](/tpl/images/cats/mat.png)
Mathematics, 13.04.2021 09:10
![question](/tpl/images/cats/mat.png)
Mathematics, 13.04.2021 09:10
![question](/tpl/images/cats/istoriya.png)
![question](/tpl/images/cats/es.png)
![question](/tpl/images/cats/geografiya.png)
Geography, 13.04.2021 09:10
![question](/tpl/images/cats/health.png)
![question](/tpl/images/cats/en.png)
![question](/tpl/images/cats/ekonomika.png)
Business, 13.04.2021 09:10
![question](/tpl/images/cats/istoriya.png)