1. The following sequence was taken from a DNA molecule 5'- AACCTTTAGGGCCCTTTAAA - 3'
Given that the temperature required breaking, one bond in the molecule is 12°C. What is
the total temperature required to completely break the entire DNA molecule.
a 48°C
b. 57.6°C
C. 240°C
d. 480°C
e. 576°C

4. how does a phospholipid behave in water? the phosphate head does not mix with water; the fatty acid tails do. the phosphate head and the fatty acid tails mix with water. the phosphate head and the fatty acid tails do not mix with water. the phosphate head mixes with water; the fatty acid tails do not.

The law of thermodynamics states that energy can't be created or destroyed. to natural sources of energy on earth are the

Identify the area on the image where the force of attraction is the strongest.