subject
Biology, 30.07.2020 23:01 apples2190

Which is a function of the digestive system? A) to produce offspring

B) to produce secretions that regulate the body

C) to serve as a framework for the attachment of muscles

D.) to convert food into simpler chemical compounds that can be absorbed and used by the body

ansver
Answers: 3

Another question on Biology

question
Biology, 22.06.2019 05:50
Is there any species that went extinct in recent years due to natural causes (not caused by human interaction). if so, what caused it?
Answers: 3
question
Biology, 22.06.2019 06:00
Guinea pig coat color is determined by a single gene. the allele for black coat color is dominant to brown. in a cross between twoblack-haired guinea pigs, 20 offspring are born. if both parents were heterozygous, probability would predict that approximately howmany of the 20 offspring would have brown hair?
Answers: 1
question
Biology, 22.06.2019 12:00
Due i have no idea on this brainliest to the best answer. case #28104 last month, hudson national bank was robbed by an unidentified man. the robber wore gloves, a hat, and a bandana that covered his face. a security guard attempting to stop the robber was knocked unconscious in a struggle. however, the guard managed to pull the hat from the robber's head. witness accounts and security tapes led police to arrest three possible suspects. none of the suspects have alibis, but police are not certain which man is the robber. using hair samples from the hat recovered by the security guard, the crime lab did a southern blot test. hair samples were also taken from each suspect. use the suspects' hair samples to determine the guilty party. suspect a tccatcca / tccatccatcca / tcca / ggcttacctataagg / tggatggatggatggatgga suspect b tccatcca / tccatccaattg / tcca / tccatccatccatccatcca / tggatggatggatgga suspect c ttagcta / ccggtatga / aggt / cgttatcggatata / ggttaggacctatcgataga probe aggt questions answer these following questions in the essay box below. a. which suspect most likely committed the robbery? b. how do you know?
Answers: 1
question
Biology, 22.06.2019 16:00
Lupe is a carrier for color blindness. her husband clifford is colorblind. if lupe and clifford have four children, what's the probability of a boy being colorblind?
Answers: 3
You know the right answer?
Which is a function of the digestive system? A) to produce offspring

B) to produce secre...
Questions
question
Chemistry, 02.04.2020 00:58
question
Mathematics, 02.04.2020 00:58
question
Mathematics, 02.04.2020 00:58
Questions on the website: 13722365