AUGGUUACCAUCGCUUAUAA TRANSLATE

Cells destroy body cells infected by a virus or bacteria.

The human genome project is devoted to mapping the general dna sequence of our species. this could lead to the development of new medicines, as well as the possibility of using gene therapy to treat certain diseases. however, there are some ethical issues surrounding the mapping of individual genomes. one concern is a) that your genes may change over time, making the project useless. b) that insurance companies could discriminate based on genetic make-up. c) that since this has never been done before, we should probably not do it now. d) that sequencing our individual genomes is so expensive, it is a counter-productive strategy.

The large increase in atmospheric carbon dioxide in the last 50 years most likely comes from a. an increase in cellular respiration b. increased decomposition by bacteria c. an increase in the burning of fossil fuels d. an increase in photosynthesis