Answers: 2
Biology, 22.06.2019 12:00
Due i have no idea on this brainliest to the best answer. case #28104 last month, hudson national bank was robbed by an unidentified man. the robber wore gloves, a hat, and a bandana that covered his face. a security guard attempting to stop the robber was knocked unconscious in a struggle. however, the guard managed to pull the hat from the robber's head. witness accounts and security tapes led police to arrest three possible suspects. none of the suspects have alibis, but police are not certain which man is the robber. using hair samples from the hat recovered by the security guard, the crime lab did a southern blot test. hair samples were also taken from each suspect. use the suspects' hair samples to determine the guilty party. suspect a tccatcca / tccatccatcca / tcca / ggcttacctataagg / tggatggatggatggatgga suspect b tccatcca / tccatccaattg / tcca / tccatccatccatccatcca / tggatggatggatgga suspect c ttagcta / ccggtatga / aggt / cgttatcggatata / ggttaggacctatcgataga probe aggt questions answer these following questions in the essay box below. a. which suspect most likely committed the robbery? b. how do you know?
Answers: 1
Biology, 22.06.2019 12:10
People with one sickle cell allele are not likely to get malaria. what is this an example of?
Answers: 1
Biology, 22.06.2019 13:20
Which cell organelle is the site for photosynthesis? a. chloroplast b. endoplasmic reticulum c. golgi apparatus d. lysosome
Answers: 1
Biology, 22.06.2019 13:30
What kinds of molecules can pass through the cell membrane without any problem?
Answers: 1
In the lock-and-key model of enzyme action, the enzyme active site is thought of as ....
Computers and Technology, 08.10.2019 17:30
Mathematics, 08.10.2019 17:30
Mathematics, 08.10.2019 17:30
History, 08.10.2019 17:30
English, 08.10.2019 17:30
Business, 08.10.2019 17:30