![subject](/tpl/images/cats/biologiya.png)
Biology, 19.08.2020 01:01 michael3677
Green pigmented plastids that function in photosynthesis are called
![ansver](/tpl/images/cats/User.png)
Answers: 2
![](/tpl/images/ask_question.png)
![](/tpl/images/ask_question_mob.png)
Another question on Biology
![question](/tpl/images/cats/biologiya.png)
Biology, 22.06.2019 05:30
Amniocentesis is a process in which amniotic fluid is taken from the mother's womb to identify any genetic abnormalities in the fetus. how would the discovery of the human genome contribute to this process?
Answers: 1
![question](/tpl/images/cats/biologiya.png)
Biology, 22.06.2019 08:10
Match the functions to the cell types ? contraction and relaxation. conducting electrochemical signals fighting diseases carrying genetic material
Answers: 1
![question](/tpl/images/cats/biologiya.png)
Biology, 22.06.2019 10:30
16. which of the following accurately describes a step within transcription? a. dna polymerase uses one strand of rna as a template to put together nucleotides. b. the dna strand is used as a template for which a complementary rna strand can be produced. c. the rna strand forms a template by which dna can be built. d. the rna strand is produced within the cytoplasm.
Answers: 3
![question](/tpl/images/cats/biologiya.png)
Biology, 22.06.2019 12:00
Due i have no idea on this brainliest to the best answer. case #28104 last month, hudson national bank was robbed by an unidentified man. the robber wore gloves, a hat, and a bandana that covered his face. a security guard attempting to stop the robber was knocked unconscious in a struggle. however, the guard managed to pull the hat from the robber's head. witness accounts and security tapes led police to arrest three possible suspects. none of the suspects have alibis, but police are not certain which man is the robber. using hair samples from the hat recovered by the security guard, the crime lab did a southern blot test. hair samples were also taken from each suspect. use the suspects' hair samples to determine the guilty party. suspect a tccatcca / tccatccatcca / tcca / ggcttacctataagg / tggatggatggatggatgga suspect b tccatcca / tccatccaattg / tcca / tccatccatccatccatcca / tggatggatggatgga suspect c ttagcta / ccggtatga / aggt / cgttatcggatata / ggttaggacctatcgataga probe aggt questions answer these following questions in the essay box below. a. which suspect most likely committed the robbery? b. how do you know?
Answers: 1
You know the right answer?
Green pigmented plastids that function in photosynthesis are called...
Questions
![question](/tpl/images/cats/en.png)
![question](/tpl/images/cats/istoriya.png)
![question](/tpl/images/cats/biologiya.png)
![question](/tpl/images/cats/fizika.png)
Physics, 27.05.2021 21:40
![question](/tpl/images/cats/mat.png)
Mathematics, 27.05.2021 21:40
![question](/tpl/images/cats/mat.png)
![question](/tpl/images/cats/mat.png)
Mathematics, 27.05.2021 21:40
![question](/tpl/images/cats/istoriya.png)
![question](/tpl/images/cats/himiya.png)
![question](/tpl/images/cats/mat.png)
Mathematics, 27.05.2021 21:40
![question](/tpl/images/cats/mat.png)
![question](/tpl/images/cats/mat.png)
Mathematics, 27.05.2021 21:40
![question](/tpl/images/cats/fizika.png)
Physics, 27.05.2021 21:40
![question](/tpl/images/cats/mat.png)
Mathematics, 27.05.2021 21:40
![question](/tpl/images/cats/mat.png)
Mathematics, 27.05.2021 21:40
![question](/tpl/images/cats/en.png)
English, 27.05.2021 21:40
![question](/tpl/images/cats/biologiya.png)
Biology, 27.05.2021 21:40
![question](/tpl/images/cats/en.png)
English, 27.05.2021 21:40
![question](/tpl/images/cats/mat.png)