Name: malcolm . Chapters 1 & 2 Review BIOLOGY: UNIT 1 Directions: Answer the following questions using your lecture notes and textbook for Chapters 1 and 2 by typing your answers into the yellow highlighted boxes. 1. What is the smallest unit of matter? atom . 2. What characteristics do all living things share? . 3. What is homeostasis? . 4. What are the advantages of using computer models in biological research? . 5. What is a hypothesis? . 6. What is a theory? . 7. What is the definition of a species? . 8. What are the four main types of carbon-based compounds found in living things? . 9. What is an ion? . 10. What unique quality does carbon possess that allows it to form large organic compounds? . 11. What are the steps in the Scientific Method? . 12. What is a controlled experiment? . 13. What aspect of a chemical reaction is affected by enzymes? . 14. What is the name given for genetic changes in living things over time? . 15. How does a catalyst speed up a chemical reaction? . 16. What is the pH of an acid, a base, and a neutral solution? . 17. During an experiment, which factors are observed and measured? . 18. What is the difference between a covalent and ionic bond? . 19. Complete the table below: Organic Compound Monomer Polymer Carbohydrate Lipid Protein Nucleic Acid 20. What is biodiversity? . 21. What is the negative feedback process? . 22. What are the three particles found in an atom, and where are they found in the atom? . 23. Identify the reactants and products in the chemical reaction below left reactant right products . 6CO2 + 6H2O → C6H12O6 + 6O2 24. What is a monosaccharide and a polysaccharide? . 25. When enough experimental data supports a hypothesis, the hypothesis becomes a(an)? .

Experiments in environmental toxicology can sometimes be manipulative experiments in which the researcher actively chooses and manipulates the independent variable. in hunt's study, for example, dosages of bpa were manipulated and the effects were measured. in manipulative studies, the researcher controls all the other variables in the experiment, so any health effects observed in the test subjects can be attributed to differences in the independent variable. in other cases, researchers use natural experiments in which the dependent variable (typically a measure of organism health) is measured under differing contexts that are not manipulated. say, for example, that an accidental chemical spill contaminates five ponds. to determine the possible effects of the toxic chemical on frogs, a researcher could compare the hatching rate of frog eggs laid in those five ponds to the hatching rate of eggs laid in five uncontaminated ponds nearby. this would be an example of a natural experiment because concentrations of the toxic chemical in the ponds were not controlled by the experimenter, but rather resulted from the chemical spill. drag type of experiment on the left to the example of experiment on the right. blood concentrations of bpa in college students are compared to their recent manipulative consumption of canned food items 2. the feeding behavior of fish in streams that receive acidic runoff from strip mines is compared to the feeding behavior of fish in unaffected streams. the deformity rate in baby birds from nests in pesticide-sprayed fields is compared to the deformity rate in birds from nests in unsprayed fields 4 tumor development is compared in mice exposed to five dosages of a known carcinogen in the laboratory foraging activity levels are compared in tadpoles exposed to four concentrations of toxic metals in the laboratory. growth of corn plants is compared in field plots sprayed with three different dosage: s of weed killer 7 bpa concentrations in the urine of people with diabetes are compared to bpa concentrations in the urine of people without diabetes - natural; manipulative

Due i have no idea on this brainliest to the best answer. case #28104 last month, hudson national bank was robbed by an unidentified man. the robber wore gloves, a hat, and a bandana that covered his face. a security guard attempting to stop the robber was knocked unconscious in a struggle. however, the guard managed to pull the hat from the robber's head. witness accounts and security tapes led police to arrest three possible suspects. none of the suspects have alibis, but police are not certain which man is the robber. using hair samples from the hat recovered by the security guard, the crime lab did a southern blot test. hair samples were also taken from each suspect. use the suspects' hair samples to determine the guilty party. suspect a tccatcca / tccatccatcca / tcca / ggcttacctataagg / tggatggatggatggatgga suspect b tccatcca / tccatccaattg / tcca / tccatccatccatccatcca / tggatggatggatgga suspect c ttagcta / ccggtatga / aggt / cgttatcggatata / ggttaggacctatcgataga probe aggt questions answer these following questions in the essay box below. a. which suspect most likely committed the robbery? b. how do you know?

Sally, age 3 months, has a moist, red, vesicular rash on her cheeks, the backs of her hands, and her arms. her mother said sally was constantly trying to scratch the rash and often has difficulty sleeping. her father has a family history of allergic rhinitis and asthma. discussion questions. 1. review atrophic dermatitis from chapter 3 and discuss the pathophysiology of sally’s symptoms. 2. why is the father’s medical history significant, and what can sally expect as she grows up? 3. discuss the need to limit scratching, and describe practical methods to achieve this.