subject
Biology, 25.09.2020 14:01 shiahdiah

Why is precise communication crucial in science

ansver
Answers: 3

Another question on Biology

question
Biology, 22.06.2019 04:00
The tubes transporting minerals and water upward are called ?
Answers: 1
question
Biology, 22.06.2019 04:30
The first amino acid of a new polypeptide chain is
Answers: 1
question
Biology, 22.06.2019 12:00
Due i have no idea on this brainliest to the best answer. case #28104 last month, hudson national bank was robbed by an unidentified man. the robber wore gloves, a hat, and a bandana that covered his face. a security guard attempting to stop the robber was knocked unconscious in a struggle. however, the guard managed to pull the hat from the robber's head. witness accounts and security tapes led police to arrest three possible suspects. none of the suspects have alibis, but police are not certain which man is the robber. using hair samples from the hat recovered by the security guard, the crime lab did a southern blot test. hair samples were also taken from each suspect. use the suspects' hair samples to determine the guilty party. suspect a tccatcca / tccatccatcca / tcca / ggcttacctataagg / tggatggatggatggatgga suspect b tccatcca / tccatccaattg / tcca / tccatccatccatccatcca / tggatggatggatgga suspect c ttagcta / ccggtatga / aggt / cgttatcggatata / ggttaggacctatcgataga probe aggt questions answer these following questions in the essay box below. a. which suspect most likely committed the robbery? b. how do you know?
Answers: 1
question
Biology, 22.06.2019 13:00
Plz ! what does it mean for an allele to be dominant?
Answers: 1
You know the right answer?
Why is precise communication crucial in science...
Questions
question
Social Studies, 18.07.2019 09:50
question
Mathematics, 18.07.2019 10:00
question
Biology, 18.07.2019 10:00
Questions on the website: 13722363