Answers: 1
Biology, 22.06.2019 01:00
Dermal tissue in plants stores 1.extra food 2.transports water and nutrients 3.transports waste materials 4.is similar to epithelial cells in animals
Answers: 1
Biology, 22.06.2019 01:30
What macromolecule is produced during translation? a. carbohydrate b. rna c. dna d. protein
Answers: 2
Biology, 22.06.2019 08:00
Aparent with freckles is crossed with a parent without freckles. the punnett square shows the possible genotypes and phenotypes of the offspring. which statement accurately describes the probability of phenotypes? a.the offspring are more likely to have freckles. b.the offspring are more likely to have no freckles. c.the likelihood of the offspring having freckles and not having freckles is the same. d.the likelihood of the offspring having freckles and not having freckles cannot be determined.
Answers: 1
Biology, 22.06.2019 12:00
Due i have no idea on this brainliest to the best answer. case #28104 last month, hudson national bank was robbed by an unidentified man. the robber wore gloves, a hat, and a bandana that covered his face. a security guard attempting to stop the robber was knocked unconscious in a struggle. however, the guard managed to pull the hat from the robber's head. witness accounts and security tapes led police to arrest three possible suspects. none of the suspects have alibis, but police are not certain which man is the robber. using hair samples from the hat recovered by the security guard, the crime lab did a southern blot test. hair samples were also taken from each suspect. use the suspects' hair samples to determine the guilty party. suspect a tccatcca / tccatccatcca / tcca / ggcttacctataagg / tggatggatggatggatgga suspect b tccatcca / tccatccaattg / tcca / tccatccatccatccatcca / tggatggatggatgga suspect c ttagcta / ccggtatga / aggt / cgttatcggatata / ggttaggacctatcgataga probe aggt questions answer these following questions in the essay box below. a. which suspect most likely committed the robbery? b. how do you know?
Answers: 1
Where would you find the cell wall...
Mathematics, 27.07.2019 20:20
Mathematics, 27.07.2019 20:20
Chemistry, 27.07.2019 20:20
Geography, 27.07.2019 20:20
English, 27.07.2019 20:20
English, 27.07.2019 20:20