subject

Biology, 04.10.2020 18:01 kayliebug2003

A single strand of DNA is ATTCGGCTATTTACGATTGCCAT what is the other strand?

ansver

Answers: 2

Show answers

Another question on Biology

question

Biology, 21.06.2019 21:00

What two fields of study provide the core information that is used to classify organisms?

Answers: 2

question

Biology, 22.06.2019 00:30

Which beat describes the brain stem

Answers: 1

question

Biology, 22.06.2019 02:30

Plz ! a scientist wants to produce a cow that makes a particular human protein in it’s milk the desired protein causes blood to clot and can be used to treat hemophilia (a blood clotting disorder). which of the following would be best for the scientist to use? a. genetic crosses. b. cloning. c. selective breeding. d. genetic engineering.

Answers: 1

question

Biology, 22.06.2019 03:00

Which sentence best describes the relationship between chlorophyll and the chloroplast? a.)chlorophyll is a chemical found in a chloroplast. b.) chloroplast is a chemical found in a chlorophyll. c.) both chlorophyll and chloroplasts are found in animals. d.) both chlorophyll and chloroplasts make carbon dioxide.

Answers: 1

You know the right answer?

A single strand of DNA is ATTCGGCTATTTACGATTGCCAT what is the other strand?...

Questions

question

Geography, 10.10.2019 14:30

Tenochtitlan covered the area of what is now veracruz zacatecas chiapas mexico city...

question

Mathematics, 10.10.2019 14:30

Ineed a how i do the sloving multi-step in the easy way✌

question

History, 10.10.2019 14:30

Which is true of the federal level of government and the state and local level in the creation of public policy? a)both give most of the power...

question

Biology, 10.10.2019 14:30

Which of these chemicals is needed in order for the metabolic reactions of photosynthesis to occur? a) fructose b) glucose c) oxy...

question

English, 10.10.2019 14:30

Why is macbeth upset when he sees malcolms army carrying branches from birnam wood?...

question

Biology, 10.10.2019 14:30

In all muscle cells, two kinds of protein filaments slide past each other to shorten the muscle cell and generate force. what broad theme of biology d...

question

History, 10.10.2019 14:30

Click to select the correct answers. click again to unselect answers. leave the incorrect answers unselected. choose the statements that correctly des...

question

Chemistry, 10.10.2019 14:30

What is the reason that could cause species to become extinct ?...

question

English, 10.10.2019 14:30

Which phrase best defines the denotative meaning of a word? a) the feelings and associations the word evokes b) the literal meaning of...

question

Social Studies, 10.10.2019 14:30

Apossible warning signal that you may be headed for financial problems with credit is that you a. pay only the minimum required. c. you on...

question

History, 10.10.2019 14:30

Which of the following is best considered a statement of the public interest? a."promote the general welfare" b."grain inspection, packer...

question

Mathematics, 10.10.2019 14:30

Find the missing value for the exponential function represented by the table below. -2 , 26 -1 , 18.2 0, 12.74 1 ...

question

Mathematics, 10.10.2019 14:30

(06.01) solve the following system of equations and show all work. y=−x^2+6 y=3x−4

question

Mathematics, 10.10.2019 14:30

At the end of the year a library imported 32 books lost or stolen and 24 books were sent out for repair if the library originally had 1208 19 books ho...

question

Mathematics, 10.10.2019 14:30

Which inequality represents the problem? a swan can dive below sea level at a rate of 3 feet per second. how many seconds wi...

question

Mathematics, 10.10.2019 14:30

Arectangle's length and width are in a ratio of 8: 3. the area is 384 square millimeters. what are the length and width? i really am desp...

question

Social Studies, 10.10.2019 14:30

The rwandan genocide took place in which year? a.1962 b.1994 c.1992 d.1967...

question

Health, 10.10.2019 14:30

What occurs when gametes fuse during sexual reproduction? a. puberty b. secondary sex characterization c. asexual reproduction

question

World Languages, 10.10.2019 14:30

Frederick douglass fought for and for the right to vote. a. abolition; suffrage b. freedom; abolitionism c. civil rights; eg...

question

Mathematics, 10.10.2019 14:30

An equation is written to represent the relationship between the temperature in alaska during a snow storm, y, as it relates to the time in hours, x,...

More questions: Biology Another questions

Questions on the website: 13722362