subject
Biology, 13.10.2020 06:01 IsPink

What is the function of the cell wall? to protect and support the cell

to prevent water from passing through it

to perform different functions

to prevent oxygen from entering and existing

ansver
Answers: 3

Another question on Biology

question
Biology, 21.06.2019 23:00
Compare the depth of field when focusing with low power and high power. which power has the greater depth of field?
Answers: 1
question
Biology, 22.06.2019 05:00
Jason adds the antibiotic penicillin to a bacterial culture. the bacteria develop genetic modifications in their genome, which gives them resistance to the antibiotic penicillin. what caused this genetic modification?
Answers: 2
question
Biology, 22.06.2019 12:00
Due i have no idea on this brainliest to the best answer. case #28104 last month, hudson national bank was robbed by an unidentified man. the robber wore gloves, a hat, and a bandana that covered his face. a security guard attempting to stop the robber was knocked unconscious in a struggle. however, the guard managed to pull the hat from the robber's head. witness accounts and security tapes led police to arrest three possible suspects. none of the suspects have alibis, but police are not certain which man is the robber. using hair samples from the hat recovered by the security guard, the crime lab did a southern blot test. hair samples were also taken from each suspect. use the suspects' hair samples to determine the guilty party. suspect a tccatcca / tccatccatcca / tcca / ggcttacctataagg / tggatggatggatggatgga suspect b tccatcca / tccatccaattg / tcca / tccatccatccatccatcca / tggatggatggatgga suspect c ttagcta / ccggtatga / aggt / cgttatcggatata / ggttaggacctatcgataga probe aggt questions answer these following questions in the essay box below. a. which suspect most likely committed the robbery? b. how do you know?
Answers: 1
question
Biology, 22.06.2019 13:00
Substances that can pass through cell membranes by diffusion include a. na ions. b. proteins c. glucose. d. oxygen.
Answers: 3
You know the right answer?
What is the function of the cell wall? to protect and support the cell

to prevent water...
Questions
question
Mathematics, 26.10.2020 14:00
question
Mathematics, 26.10.2020 14:00
question
Mathematics, 26.10.2020 14:00
question
Mathematics, 26.10.2020 14:00
question
Mathematics, 26.10.2020 14:00
question
Business, 26.10.2020 14:00
question
Engineering, 26.10.2020 14:00
question
Mathematics, 26.10.2020 14:00
question
Biology, 26.10.2020 14:00
Questions on the website: 13722361