subject
Biology, 16.10.2020 07:01 mswillm

Shifting biomes could have consequences for the regions in which the shifts occur. Read the two cases below and decide which consequences would apply to one or both cases. Case 1: The biome of a small agricultural community in the western United States changes from grassland to desert. A species of migrating duck, which can carry bird flu, goes locally extinct. Case 2: The biome in northern Russia changes from tundra to taiga. Timber harvesting in the region becomes possible. Arctic foxes go locally extinct and are replaced by red foxes that commonly carry rabies. Sort each consequence based on whether it would apply to Case 1, Case 2, or botha. increased risk of wildfiresb. local economy suffersc. carbon storage decreasesd. agricultural production decreasese. carbon storage increasesf. disease vector range changesg. decreased water availabilityh. local economy thrivesi. species range changesCase 1Case 2Cases 1 and 2

ansver
Answers: 3

Another question on Biology

question
Biology, 22.06.2019 01:30
Plz ! ive been stuck on this forever
Answers: 1
question
Biology, 22.06.2019 06:30
Match the pollutants. 1. a chlorofluorocarbon smoke 2. a biodegradable organophosphate insecticide freon 3. particle pollution paint 4. hazardous waste monoxide 5. carbon is completely burned malathion 6. carbon is incompletely burned dioxide
Answers: 2
question
Biology, 22.06.2019 12:00
Due i have no idea on this brainliest to the best answer. case #28104 last month, hudson national bank was robbed by an unidentified man. the robber wore gloves, a hat, and a bandana that covered his face. a security guard attempting to stop the robber was knocked unconscious in a struggle. however, the guard managed to pull the hat from the robber's head. witness accounts and security tapes led police to arrest three possible suspects. none of the suspects have alibis, but police are not certain which man is the robber. using hair samples from the hat recovered by the security guard, the crime lab did a southern blot test. hair samples were also taken from each suspect. use the suspects' hair samples to determine the guilty party. suspect a tccatcca / tccatccatcca / tcca / ggcttacctataagg / tggatggatggatggatgga suspect b tccatcca / tccatccaattg / tcca / tccatccatccatccatcca / tggatggatggatgga suspect c ttagcta / ccggtatga / aggt / cgttatcggatata / ggttaggacctatcgataga probe aggt questions answer these following questions in the essay box below. a. which suspect most likely committed the robbery? b. how do you know?
Answers: 1
question
Biology, 22.06.2019 13:30
How does the color of light affect the germination time (amount time a plant takes to develop) of a radish seed?
Answers: 3
You know the right answer?
Shifting biomes could have consequences for the regions in which the shifts occur. Read the two case...
Questions
question
Mathematics, 16.12.2019 09:31
question
Mathematics, 16.12.2019 09:31
question
Mathematics, 16.12.2019 09:31
Questions on the website: 13722363