Biology, 19.10.2020 08:01 bobiscool3698
This sequence encodes for a particular protein that helps bacteria move. A mutation occurs in the sequence, leading to a faulty protein. Identify the sequences where the mutation might have taken place.
ATTTGCATACTACCGGGC
The letters in bold with a yellow highlight are the noncoding region, and the other letters are the protein coding region.
Group of answer choices
ATTTGCAATACTACCGGGC
ATGAATGCATACTACCGGGC
ATTTGCATACTGACCGGGC
ATTTGCAACTACCGGGC
ATTAGCATACTACGGGC
Answers: 2
Another question on Biology
Biology, 21.06.2019 23:30
The table shows dates and appearance of index fossils. which rock layers can be dated most precisely? a) a layer containing both a fossil 4 and a fossil 3 b) a layer containing both a fossil 2 and a fossil 3 c) a layer containing both a fossil 1 and a fossil 4 d) a layer containing both a fossil 1 and a fossil 2
Answers: 2
Biology, 22.06.2019 17:00
The data below simulate what happened to peppered moths in england after the industrial revolution which statement best describes the process that produced one of the emding populations of moths ?light colored moths were selected for on light colored trees
Answers: 3
Biology, 23.06.2019 01:00
Why did benjamin franklin refuse to write the declaration of independence? a. he did not want his humor to distract from the document's purpose. b. he was not from a southern colony. c. his poor vision made it difficult to write.
Answers: 2
You know the right answer?
This sequence encodes for a particular protein that helps bacteria move. A mutation occurs in the se...
Questions
Physics, 28.10.2020 01:00
Mathematics, 28.10.2020 01:00
History, 28.10.2020 01:00
Biology, 28.10.2020 01:00
Mathematics, 28.10.2020 01:00
Mathematics, 28.10.2020 01:00
Mathematics, 28.10.2020 01:00
Biology, 28.10.2020 01:00
English, 28.10.2020 01:00
Mathematics, 28.10.2020 01:00
Health, 28.10.2020 01:00
Mathematics, 28.10.2020 01:00
Spanish, 28.10.2020 01:00
Mathematics, 28.10.2020 01:00
