*MAY* give brainliest!
Please give answer and explain:
This sequence encodes for a part...
Biology, 19.10.2020 08:01 dflorez3064
*MAY* give brainliest!
Please give answer and explain:
This sequence encodes for a particular protein that helps bacteria move. A mutation occurs in the sequence, leading to a faulty protein. Identify the sequences where the mutation might have taken place.
ATTTGCATACTACCGGGC
The letters in bold with a yellow highlight are the noncoding region, and the other letters are the protein coding region.
Group of answer choices
ATTTGCAATACTACCGGGC
ATGAATGCATACTACCGGGC
ATTTGCATACTGACCGGGC
ATTTGCAACTACCGGGC
ATTAGCATACTACGGGC
Highlighted letters are: ATACTACC
Answers: 2
Biology, 22.06.2019 03:00
Which sentence best describes the relationship between chlorophyll and the chloroplast? a.)chlorophyll is a chemical found in a chloroplast. b.) chloroplast is a chemical found in a chlorophyll. c.) both chlorophyll and chloroplasts are found in animals. d.) both chlorophyll and chloroplasts make carbon dioxide.
Answers: 1
Biology, 22.06.2019 06:50
Which organelle breaks down sugar molecules that supply energy to the cell ?
Answers: 2
Biology, 22.06.2019 13:00
This is an active transport mechanism by which cells pump sodium and potassium ions against the concentration gradient
Answers: 1
Biology, 22.06.2019 20:30
The passing on of genetic traits from parents to offspring.
Answers: 3
History, 10.03.2021 19:00
Mathematics, 10.03.2021 19:00
History, 10.03.2021 19:00
Mathematics, 10.03.2021 19:00
Mathematics, 10.03.2021 19:00
Mathematics, 10.03.2021 19:00
Mathematics, 10.03.2021 19:00
Mathematics, 10.03.2021 19:00
Mathematics, 10.03.2021 19:00
Chemistry, 10.03.2021 19:00
Mathematics, 10.03.2021 19:00