The restriction onzyme EcoR1 recognizes the sequence: CATTO OTTAAG And outs the DNA botwoon the and the A on both strands. How many restriction sites are there in the following sequence? ATTOTTOMTTCOTATTGAATTCCO TACACTTAGCATAATTAAGGG
1)none
2)one
3)not enough information
4)three
5)two.

How do chloroplasts set plants apart from other living things

Drag each label to the correct location on the table. each label can be used more than once. decide whether each statement describes saturated fat, unsaturated fat, or both saturated and unsaturated fats.

Which of the following is an example of competition that could be found in a forest? question 14 options: deer eat berries and their droppings seed new areas creating more berry bushes two fox populations utilize the same rabbit population as their main food source two hawk populations utilize the same scorpion population as their main food source lack of sunlight due to changes in the seasons restricts the growth of certain plants