![subject](/tpl/images/cats/biologiya.png)
Biology, 26.10.2020 16:40 mdlemuslopez
explain why nonpolar compounds are generally able to diffuse across biological membranes without the aid of a specific transport system.
![ansver](/tpl/images/cats/User.png)
Answers: 1
![](/tpl/images/ask_question.png)
![](/tpl/images/ask_question_mob.png)
Another question on Biology
![question](/tpl/images/cats/biologiya.png)
Biology, 21.06.2019 13:30
Q1.8. continuing your studies, you perform a transplant experiment. you chisel up multiple rocks from the upper intertidal zone, each holding 10 individuals of species a, and move them to the lower intertidal zone among individuals of species c. you count the number of individuals of all species on the rocks every day for 30 days. based on your findings, what can you conclude? (remember that all 3 species settle in this zone at equal rates.)
Answers: 3
![question](/tpl/images/cats/biologiya.png)
Biology, 22.06.2019 06:30
How have high taxes on tobacco products impacted the number of people who use them? a. the number of tobacco users has increased. b. the number of tobacco users has decreased. c. the number of tobacco users has not changed. d. the number of adolescent tobacco users decreased, while the number of adult users increased
Answers: 2
![question](/tpl/images/cats/biologiya.png)
Biology, 22.06.2019 12:00
Due i have no idea on this brainliest to the best answer. case #28104 last month, hudson national bank was robbed by an unidentified man. the robber wore gloves, a hat, and a bandana that covered his face. a security guard attempting to stop the robber was knocked unconscious in a struggle. however, the guard managed to pull the hat from the robber's head. witness accounts and security tapes led police to arrest three possible suspects. none of the suspects have alibis, but police are not certain which man is the robber. using hair samples from the hat recovered by the security guard, the crime lab did a southern blot test. hair samples were also taken from each suspect. use the suspects' hair samples to determine the guilty party. suspect a tccatcca / tccatccatcca / tcca / ggcttacctataagg / tggatggatggatggatgga suspect b tccatcca / tccatccaattg / tcca / tccatccatccatccatcca / tggatggatggatgga suspect c ttagcta / ccggtatga / aggt / cgttatcggatata / ggttaggacctatcgataga probe aggt questions answer these following questions in the essay box below. a. which suspect most likely committed the robbery? b. how do you know?
Answers: 1
![question](/tpl/images/cats/biologiya.png)
Biology, 22.06.2019 13:40
1. -define adaptation2 explain darwin's theories of descent with modification and natural selection in detail3. -explain how each of these provides evidence for evolution: a. -fossil record, including superposition and transitional fossilsb-anatomy, including homologous structuresc-biological molecules, including dna and proteins4. -explain the difference between convergent and divergent evolution.5. -define and give three examples of artificial selection6. -define and give one example of coevolution.7. -explain biodiversity and how it benefits humans.8. -explain a type of population lest affected by environmental change.
Answers: 3
You know the right answer?
explain why nonpolar compounds are generally able to diffuse across biological membranes without the...
Questions
![question](/tpl/images/cats/mat.png)
Mathematics, 11.09.2020 01:01
![question](/tpl/images/cats/mat.png)
Mathematics, 11.09.2020 01:01
![question](/tpl/images/cats/mat.png)
Mathematics, 11.09.2020 01:01
![question](/tpl/images/cats/mat.png)
Mathematics, 11.09.2020 01:01
![question](/tpl/images/cats/mat.png)
Mathematics, 11.09.2020 01:01
![question](/tpl/images/cats/mat.png)
Mathematics, 11.09.2020 01:01
![question](/tpl/images/cats/mat.png)
Mathematics, 11.09.2020 01:01
![question](/tpl/images/cats/mat.png)
Mathematics, 11.09.2020 01:01
![question](/tpl/images/cats/en.png)
English, 11.09.2020 01:01
![question](/tpl/images/cats/mat.png)
Mathematics, 11.09.2020 01:01
![question](/tpl/images/cats/mat.png)
Mathematics, 11.09.2020 01:01
![question](/tpl/images/cats/mat.png)
Mathematics, 11.09.2020 01:01
![question](/tpl/images/cats/mat.png)
Mathematics, 11.09.2020 01:01
![question](/tpl/images/cats/obshestvoznanie.png)
Social Studies, 11.09.2020 01:01
![question](/tpl/images/cats/biologiya.png)
Biology, 11.09.2020 01:01
![question](/tpl/images/cats/mat.png)
Mathematics, 11.09.2020 01:01
![question](/tpl/images/cats/mat.png)
Mathematics, 11.09.2020 01:01
![question](/tpl/images/cats/mat.png)
Mathematics, 11.09.2020 01:01
![question](/tpl/images/cats/mat.png)
Mathematics, 11.09.2020 01:01
![question](/tpl/images/cats/mat.png)
Mathematics, 11.09.2020 01:01