![subject](/tpl/images/cats/biologiya.png)
![ansver](/tpl/images/cats/User.png)
Answers: 3
![](/tpl/images/ask_question.png)
![](/tpl/images/ask_question_mob.png)
Another question on Biology
![question](/tpl/images/cats/biologiya.png)
Biology, 22.06.2019 09:30
Parthenogenesis is a type of reproduction that does not require a mate. itβs rarely seen in birds and higher vertebrates. parthenogenesis involves the formation of a zygote. but this zygote is formed without fertilization. in parthenogenesis, in the absence of a male gamete, the ovum develops directly in the zygote.
Answers: 1
![question](/tpl/images/cats/biologiya.png)
Biology, 22.06.2019 10:50
What is it called when part of a cell membrane closes around a molecule to allow the molecule to enter the cell? a. passive transport b.diffusion c. endocytosis d. exocytosisc. endocytosis
Answers: 2
![question](/tpl/images/cats/biologiya.png)
Biology, 22.06.2019 11:20
Scientific evidence is most likely to be consistent if it is based on data from
Answers: 2
![question](/tpl/images/cats/biologiya.png)
Biology, 22.06.2019 12:00
Due i have no idea on this brainliest to the best answer. case #28104 last month, hudson national bank was robbed by an unidentified man. the robber wore gloves, a hat, and a bandana that covered his face. a security guard attempting to stop the robber was knocked unconscious in a struggle. however, the guard managed to pull the hat from the robber's head. witness accounts and security tapes led police to arrest three possible suspects. none of the suspects have alibis, but police are not certain which man is the robber. using hair samples from the hat recovered by the security guard, the crime lab did a southern blot test. hair samples were also taken from each suspect. use the suspects' hair samples to determine the guilty party. suspect a tccatcca / tccatccatcca / tcca / ggcttacctataagg / tggatggatggatggatgga suspect b tccatcca / tccatccaattg / tcca / tccatccatccatccatcca / tggatggatggatgga suspect c ttagcta / ccggtatga / aggt / cgttatcggatata / ggttaggacctatcgataga probe aggt questions answer these following questions in the essay box below. a. which suspect most likely committed the robbery? b. how do you know?
Answers: 1
You know the right answer?
How are new viruses made?
A.)asexual reproduction
B.)viral DNA or RNA copied by viral c...
B.)viral DNA or RNA copied by viral c...
Questions
![question](/tpl/images/cats/en.png)
![question](/tpl/images/cats/en.png)
![question](/tpl/images/cats/himiya.png)
![question](/tpl/images/cats/mat.png)
![question](/tpl/images/cats/fizika.png)
![question](/tpl/images/cats/fizika.png)
![question](/tpl/images/cats/en.png)
English, 29.07.2019 17:30
![question](/tpl/images/cats/himiya.png)
Chemistry, 29.07.2019 17:30
![question](/tpl/images/cats/mat.png)
Mathematics, 29.07.2019 17:30
![question](/tpl/images/cats/istoriya.png)
![question](/tpl/images/cats/biologiya.png)
Biology, 29.07.2019 17:30
![question](/tpl/images/cats/biologiya.png)
![question](/tpl/images/cats/himiya.png)
![question](/tpl/images/cats/himiya.png)
![question](/tpl/images/cats/istoriya.png)
History, 29.07.2019 17:30
![question](/tpl/images/cats/health.png)
Health, 29.07.2019 17:30
![question](/tpl/images/cats/himiya.png)
Chemistry, 29.07.2019 17:30
![question](/tpl/images/cats/mat.png)
![question](/tpl/images/cats/mkx.png)