GTA: TAA mRNA UCA : CAU: AUU tRNA AGU : GUA : UAA rRNA Serine Valine Stop You need to solve the entire DNA line and then answer the even numbered question below. 1) DNA GTA ATG AGT CAC CTG GCC GTA AAA CCT TAT AGA TAA ATC mRNA tRNA TRNA 2) 3) DNA mRNA tRNA rRNA 4) How many proteins were produced? ( ) TGAAGACCCATTATGTGCCTGTAATACCCAAGCTA GAAG How many proteins were

How do temperature and salinity affect deepwater currents? question 15 options: as temperatures and salinity levels of water increase, the water rises to the surface where it creates currents as it moves to colder regions. they create changes in wind direction, moving denser water in the same direction as the wind and causing the deepwater circulation patterns found in the ocean. they equalize the forces on undersea currents caused by the coriolis effect as they replace more dense water with less dense water. they create density differences that cause dense deepwater currents to flow toward the equator where they displace less dense, warmer water above them.