Answers: 3
Biology, 22.06.2019 04:20
Explain the significance of the increased cell specialization of the volvocine line
Answers: 1
Biology, 22.06.2019 12:00
Due i have no idea on this brainliest to the best answer. case #28104 last month, hudson national bank was robbed by an unidentified man. the robber wore gloves, a hat, and a bandana that covered his face. a security guard attempting to stop the robber was knocked unconscious in a struggle. however, the guard managed to pull the hat from the robber's head. witness accounts and security tapes led police to arrest three possible suspects. none of the suspects have alibis, but police are not certain which man is the robber. using hair samples from the hat recovered by the security guard, the crime lab did a southern blot test. hair samples were also taken from each suspect. use the suspects' hair samples to determine the guilty party. suspect a tccatcca / tccatccatcca / tcca / ggcttacctataagg / tggatggatggatggatgga suspect b tccatcca / tccatccaattg / tcca / tccatccatccatccatcca / tggatggatggatgga suspect c ttagcta / ccggtatga / aggt / cgttatcggatata / ggttaggacctatcgataga probe aggt questions answer these following questions in the essay box below. a. which suspect most likely committed the robbery? b. how do you know?
Answers: 1
Biology, 22.06.2019 13:00
Astudy by solloch and et. al., in 2017, gives the map above which shows the frequency of alleles with a ccr5-delta32 mutations over 87 different countries. this mutation deletes the presence of a co-receptor (ccr5) on the outside of human t-cells (lymphocytes). some viruses, such as the one responsible for the black death and human immunodeficiency virus (hiv), require this receptor for attachment to host cells during the infection process. the black death was an epidemic that passed over northern europe during the 14th century killing nearly 60% of europeans. according to this information, which explanation best explains why northern europeans show a greater immunity for hiv than some other parts of the world?
Answers: 1
Why do non polar molecules diffuse more rapidly through membranes than polar molecules?...
Biology, 09.08.2019 19:30
Biology, 09.08.2019 19:30
Biology, 09.08.2019 19:30
Biology, 09.08.2019 19:30