(AKS 4a/DOK 3) Students in a biology class were asked to develop a model that illustrates the structure, function, and renewable nature of ADP and ATP and connect their model to the role of these molecules in providing energy for cellular processes. One student's incorrect
model is presented below
000
ATP
clergy
Off-Pe 10
ADE
wie
What revision would you suggest to make it more accurate?
A. Switch the positions of "requires energy" and "releases energy"
B. Switch the positions of "dead battery" and "charged battery"
CSwitch the positions of "ATP" and "ATD"

In the practice of science, this type of reasoning is used to develop explanations.

Which of the following statements is accurate about evolution? question 10 options: natural selection only eliminates odd individuals. evolution means that a population never has changes in its genetic frequencies. mutations are always harmful. evolution means that a population undergoes changes in its gene frequencies over time.

Due i have no idea on this brainliest to the best answer. case #28104 last month, hudson national bank was robbed by an unidentified man. the robber wore gloves, a hat, and a bandana that covered his face. a security guard attempting to stop the robber was knocked unconscious in a struggle. however, the guard managed to pull the hat from the robber's head. witness accounts and security tapes led police to arrest three possible suspects. none of the suspects have alibis, but police are not certain which man is the robber. using hair samples from the hat recovered by the security guard, the crime lab did a southern blot test. hair samples were also taken from each suspect. use the suspects' hair samples to determine the guilty party. suspect a tccatcca / tccatccatcca / tcca / ggcttacctataagg / tggatggatggatggatgga suspect b tccatcca / tccatccaattg / tcca / tccatccatccatccatcca / tggatggatggatgga suspect c ttagcta / ccggtatga / aggt / cgttatcggatata / ggttaggacctatcgataga probe aggt questions answer these following questions in the essay box below. a. which suspect most likely committed the robbery? b. how do you know?