Biology, 16.11.2020 21:40 anggelkevin100

For the following question , write the word or phrase from the word bank to complete the sentences. (ecology and evolution), (“Tree of All Life”), (planets) , (molecules), (global ecology), (biotechnology), (genomics).

There are many fields of biology, and in some branches, biologists are concerned with tiny
(1) , while others study whole (2) . Biologists who study how the activities of all living organisms affect both the atmosphere and climate are working in the field of (3) . Researchers who seek to replace damaged genes that cause inherited diseases or to genetically engineer bacteria are studying (4) . Some biologists work to combine the latest genetic information with computer technology to organize all living things into a single universal
(5) "". Scientists concerned with HIV, bird flu, drug-resistant bacteria, and other pathogens are researching the (6) of infectious diseases. Scientists who look at the entire sets of DNA code contained in a wide range of organisms are studying (7) .

Answers: 3

Show answers

Another question on Biology

Biology, 21.06.2019 16:30

Which of the following are the functions of the skeletal system? blood cell production in soft marrow tissues and mineral reserves largest organ of the body for defense and support vitamin d production and pumping blood through vessels voluntary movement and contractile movement

Answers: 1

Answer

Biology, 21.06.2019 22:00

Which of the following scenarios is an example of the bottleneck effect? answers a in south africa, much of the afrikaner population is descended from a small number of dutch colonists. in this population, this is an unusually high frequency of pseudoxanthoma elasticum (pxe), an elastic tissue disorder. b four white-tailed deer are introduced to a park in finland. thirty years after their introduction scientists compare the genes in the population and find that there is no variation. c during the industrial revolution, london's air became filled with soot. as a result, birds started eating more of the lighter moths because they were easier to spot than their darker counterparts. over time, the moth population changed so that there were more darker moths than lighter ones. d 10% of the population of american alligators in an area have the recessive trait albinism. a massive flood results in the death of 80% of the population. of the remaining population, 60% have the recessive trait of albinism.

Answers: 2

Answer

Biology, 22.06.2019 07:00

What molecules will be best used to compare different species with the exact same sequence of amino acids? why would two species have the same protein even if the molecules in question is different? (hint: transcription to translation to protein).

Answers: 1

Answer

Biology, 22.06.2019 12:00

Due i have no idea on this brainliest to the best answer. case #28104 last month, hudson national bank was robbed by an unidentified man. the robber wore gloves, a hat, and a bandana that covered his face. a security guard attempting to stop the robber was knocked unconscious in a struggle. however, the guard managed to pull the hat from the robber's head. witness accounts and security tapes led police to arrest three possible suspects. none of the suspects have alibis, but police are not certain which man is the robber. using hair samples from the hat recovered by the security guard, the crime lab did a southern blot test. hair samples were also taken from each suspect. use the suspects' hair samples to determine the guilty party. suspect a tccatcca / tccatccatcca / tcca / ggcttacctataagg / tggatggatggatggatgga suspect b tccatcca / tccatccaattg / tcca / tccatccatccatccatcca / tggatggatggatgga suspect c ttagcta / ccggtatga / aggt / cgttatcggatata / ggttaggacctatcgataga probe aggt questions answer these following questions in the essay box below. a. which suspect most likely committed the robbery? b. how do you know?

Answers: 1

Answer

You know the right answer?

For the following question , write the word or phrase from the word bank to complete the sentences....

Questions