subject
Biology, 17.11.2020 23:20 carlo123

The two objects shown are made up of the same element. what else is true about both objects

ansver
Answers: 1

Another question on Biology

question
Biology, 21.06.2019 14:00
Eristics do scientists use to distinguish between organisms in different kingdoms
Answers: 1
question
Biology, 22.06.2019 02:50
Lactic acid and energy are produced in muscle cells during choose 1 aerobic respiration cellular respiration anaerobic respiration cellular division
Answers: 3
question
Biology, 22.06.2019 09:10
Hormones are chemical molecules produced by endocrine glands. one such endocrine gland is the thyroid gland, which synthesizes the thyroid hormone, which in turn affects the heart muscles. which two statements describe the probable reason for the function of the hormone? the cells in the heart have specific receptors that allow for the intake of hormones. the heart and the endocrine glands have the exact same types of cells. all cells make the same types of hormones. thyroid hormones show their effect on the heart by means of specialized cells. thyroid cells and cardiac cells have different dna.
Answers: 1
question
Biology, 22.06.2019 12:00
Due i have no idea on this brainliest to the best answer. case #28104 last month, hudson national bank was robbed by an unidentified man. the robber wore gloves, a hat, and a bandana that covered his face. a security guard attempting to stop the robber was knocked unconscious in a struggle. however, the guard managed to pull the hat from the robber's head. witness accounts and security tapes led police to arrest three possible suspects. none of the suspects have alibis, but police are not certain which man is the robber. using hair samples from the hat recovered by the security guard, the crime lab did a southern blot test. hair samples were also taken from each suspect. use the suspects' hair samples to determine the guilty party. suspect a tccatcca / tccatccatcca / tcca / ggcttacctataagg / tggatggatggatggatgga suspect b tccatcca / tccatccaattg / tcca / tccatccatccatccatcca / tggatggatggatgga suspect c ttagcta / ccggtatga / aggt / cgttatcggatata / ggttaggacctatcgataga probe aggt questions answer these following questions in the essay box below. a. which suspect most likely committed the robbery? b. how do you know?
Answers: 1
You know the right answer?
The two objects shown are made up of the same element. what else is true about both objects...
Questions
question
Mathematics, 14.12.2020 18:00
question
Mathematics, 14.12.2020 18:00
question
Mathematics, 14.12.2020 18:00
Questions on the website: 13722361