subject
Biology, 20.11.2020 01:00 kimutaitanui2228

Plzz help me guys20. Identify the independent and dependent variables in the hypotheses below: A. If a player practices longer, then he will score more points in the game.
B. If students eat a high-protein breakfast, then they will score higher on their biology test.

ansver
Answers: 3

Another question on Biology

question
Biology, 21.06.2019 21:30
How do accessory pigments chlorophyll?
Answers: 1
question
Biology, 22.06.2019 07:30
Match the reproductive structures based on their function and the system to which they belong. egg ovary sperm vas deferens vagina fallopian tube testis urethra
Answers: 1
question
Biology, 22.06.2019 12:00
Due i have no idea on this brainliest to the best answer. case #28104 last month, hudson national bank was robbed by an unidentified man. the robber wore gloves, a hat, and a bandana that covered his face. a security guard attempting to stop the robber was knocked unconscious in a struggle. however, the guard managed to pull the hat from the robber's head. witness accounts and security tapes led police to arrest three possible suspects. none of the suspects have alibis, but police are not certain which man is the robber. using hair samples from the hat recovered by the security guard, the crime lab did a southern blot test. hair samples were also taken from each suspect. use the suspects' hair samples to determine the guilty party. suspect a tccatcca / tccatccatcca / tcca / ggcttacctataagg / tggatggatggatggatgga suspect b tccatcca / tccatccaattg / tcca / tccatccatccatccatcca / tggatggatggatgga suspect c ttagcta / ccggtatga / aggt / cgttatcggatata / ggttaggacctatcgataga probe aggt questions answer these following questions in the essay box below. a. which suspect most likely committed the robbery? b. how do you know?
Answers: 1
question
Biology, 22.06.2019 17:30
The diagram shows the results when two parents are crossed. the letters represent alleles for a trait that is controlled by three different genes. which best describes this inheritance pattern? multiple allele because a trait is controlled by three different genes polygenic because the offspring have alleles from both parents multiple allele because the offspring have alleles from both parents polygenic because a trait is controlled by three different genes
Answers: 1
You know the right answer?
Plzz help me guys20. Identify the independent and dependent variables in the hypotheses below: A. I...
Questions
question
Mathematics, 31.01.2022 14:00
question
Mathematics, 31.01.2022 14:00
question
Arts, 31.01.2022 14:00
question
Mathematics, 31.01.2022 14:00
question
Mathematics, 31.01.2022 14:00
question
Social Studies, 31.01.2022 14:00
question
English, 31.01.2022 14:00
Questions on the website: 13722361