Charged pril Which of the following correctly describes why the plum pudding model is no longer accepted as an accurate model of the atom?
There aren't actually negatively charged particles in atoms.
Scientists found new evidence and revised the theory to fit the data better.
Ο Ο Ο Ο
Scientists discovered that atoms actually have positively charged particles dispersed throughout a negative mass.
Scientists revised the evidence to fit this model of the atom better.

The response is the basis for vaccination. primary secondary tertiary none of the above

Due i have no idea on this brainliest to the best answer. case #28104 last month, hudson national bank was robbed by an unidentified man. the robber wore gloves, a hat, and a bandana that covered his face. a security guard attempting to stop the robber was knocked unconscious in a struggle. however, the guard managed to pull the hat from the robber's head. witness accounts and security tapes led police to arrest three possible suspects. none of the suspects have alibis, but police are not certain which man is the robber. using hair samples from the hat recovered by the security guard, the crime lab did a southern blot test. hair samples were also taken from each suspect. use the suspects' hair samples to determine the guilty party. suspect a tccatcca / tccatccatcca / tcca / ggcttacctataagg / tggatggatggatggatgga suspect b tccatcca / tccatccaattg / tcca / tccatccatccatccatcca / tggatggatggatgga suspect c ttagcta / ccggtatga / aggt / cgttatcggatata / ggttaggacctatcgataga probe aggt questions answer these following questions in the essay box below. a. which suspect most likely committed the robbery? b. how do you know?

Cells control gene expression at which steps