subject
Biology, 25.11.2020 05:20 janelle3496

Why is the earth considered a magnet? What is a permanent magnet? describes an electromagnet

ansver
Answers: 3

Another question on Biology

question
Biology, 21.06.2019 20:00
Chlorophyll is found in plant leaves and absorbs light from the sun to enable plants to perform photosynthesis. magnesium is an important component of chlorophyll. the concentration of magnesium ions is higher in the root-hair cells of plants than in the soil. which mechanism of ion uptake would best enable a plant to produce a steady supply of chlorophyll? osmosis diffusion passive transport active transport
Answers: 1
question
Biology, 22.06.2019 09:50
Which statement describes compounds a. compounds are made of one type of atom. b. compounds cannot be represented by models. c. compounds are represented by chemical formulas. d. compounds cannot be broken down into simpler forms.
Answers: 1
question
Biology, 22.06.2019 10:30
In order to study genetic mutations, scientists must study genetic material. which statement describes the genetic material scientists are most likely studying? a) they study alleles that contain chromosomes, which are rna.b) they study alleles that contain genes, which are chromosomes.c) they study chromosomes that contain genes, which are dna segments.
Answers: 1
question
Biology, 22.06.2019 12:00
Due i have no idea on this brainliest to the best answer. case #28104 last month, hudson national bank was robbed by an unidentified man. the robber wore gloves, a hat, and a bandana that covered his face. a security guard attempting to stop the robber was knocked unconscious in a struggle. however, the guard managed to pull the hat from the robber's head. witness accounts and security tapes led police to arrest three possible suspects. none of the suspects have alibis, but police are not certain which man is the robber. using hair samples from the hat recovered by the security guard, the crime lab did a southern blot test. hair samples were also taken from each suspect. use the suspects' hair samples to determine the guilty party. suspect a tccatcca / tccatccatcca / tcca / ggcttacctataagg / tggatggatggatggatgga suspect b tccatcca / tccatccaattg / tcca / tccatccatccatccatcca / tggatggatggatgga suspect c ttagcta / ccggtatga / aggt / cgttatcggatata / ggttaggacctatcgataga probe aggt questions answer these following questions in the essay box below. a. which suspect most likely committed the robbery? b. how do you know?
Answers: 1
You know the right answer?
Why is the earth considered a magnet? What is a permanent magnet? describes an electromagnet...
Questions
question
Advanced Placement (AP), 29.08.2020 01:01
question
Biology, 29.08.2020 02:01
Questions on the website: 13722362