Answers: 2
Biology, 22.06.2019 10:10
Which example describes a mutualistic relationship between organisms? young wasps prey on caterpillars. crabs eat the remains of dead fish. tapeworms feed on food in the intestines of cats ants protect a tree on which they feed.
Answers: 2
Biology, 22.06.2019 12:00
Due i have no idea on this brainliest to the best answer. case #28104 last month, hudson national bank was robbed by an unidentified man. the robber wore gloves, a hat, and a bandana that covered his face. a security guard attempting to stop the robber was knocked unconscious in a struggle. however, the guard managed to pull the hat from the robber's head. witness accounts and security tapes led police to arrest three possible suspects. none of the suspects have alibis, but police are not certain which man is the robber. using hair samples from the hat recovered by the security guard, the crime lab did a southern blot test. hair samples were also taken from each suspect. use the suspects' hair samples to determine the guilty party. suspect a tccatcca / tccatccatcca / tcca / ggcttacctataagg / tggatggatggatggatgga suspect b tccatcca / tccatccaattg / tcca / tccatccatccatccatcca / tggatggatggatgga suspect c ttagcta / ccggtatga / aggt / cgttatcggatata / ggttaggacctatcgataga probe aggt questions answer these following questions in the essay box below. a. which suspect most likely committed the robbery? b. how do you know?
Answers: 1
Biology, 22.06.2019 13:30
Which plate boundary causes plates to collide forming mountain ranges, volcanoes, and island arcs? give an example of this type of plate boundary. 2. at which plate boundary do rifts and mid-oceans ridges form? give an example of this type of plate boundary. 3. at which plate boundary do plates slide past each other while moving in opposite directions? give an example of this type of boundary.
Answers: 1
Biology, 22.06.2019 17:00
In cattle a single gene with two alleles determines fur color the fur can be red white or roan roan fur has both red and white hair which of the following statements is true a the allele for roan fur color is dominant over red and white fur color b the allele for red fur color is dominant over white and roan fur color c the roan and white alleles are expressed independently of the other d the red and white alleles are expressed independently of each other
Answers: 1
Girl, you're thicker than a bowl of oatmeal...
Computers and Technology, 30.01.2021 01:30
Mathematics, 30.01.2021 01:30
Mathematics, 30.01.2021 01:30
Mathematics, 30.01.2021 01:30
Mathematics, 30.01.2021 01:30
History, 30.01.2021 01:30
Computers and Technology, 30.01.2021 01:30
Geography, 30.01.2021 01:30
Mathematics, 30.01.2021 01:30
Mathematics, 30.01.2021 01:30
Mathematics, 30.01.2021 01:30