![subject](/tpl/images/cats/biologiya.png)
Biology, 01.12.2020 23:30 ykpwincess
In which direction does water move across membranes, up or down the concentration gradient?
Define these 3 terms:
a. isotonic-
b. hypertonic
c. hypotonic
![ansver](/tpl/images/cats/User.png)
Answers: 2
![](/tpl/images/ask_question.png)
![](/tpl/images/ask_question_mob.png)
Another question on Biology
![question](/tpl/images/cats/biologiya.png)
Biology, 22.06.2019 06:30
Which statement describes a way in which the digestive and excretory systems work together? a. the nephrons absorb nutrients from food going to the large intestine. b. the excretory system balances blood gases in the small intestine. c. the intestinal villi filter blood and send wastes to the bladder. d. the excretory system balances the salts and water obtained from digested food
Answers: 1
![question](/tpl/images/cats/biologiya.png)
Biology, 22.06.2019 07:00
Amale bird-of-paradise uses a dance to attract mates in which it flaps its tail feathers on the ground and jumps around a potential female mate. a different male bird-of-paradise does a similar dance but it jumps around the female in the opposite direction. the female bird is only attracted to one style of dance, in one direction.
Answers: 3
![question](/tpl/images/cats/biologiya.png)
Biology, 22.06.2019 07:00
Which best describes a gene? a. a sister chromatid b. a chromosome c. a tetrad d. a piece of a chromosome
Answers: 2
![question](/tpl/images/cats/biologiya.png)
Biology, 22.06.2019 12:00
Due i have no idea on this brainliest to the best answer. case #28104 last month, hudson national bank was robbed by an unidentified man. the robber wore gloves, a hat, and a bandana that covered his face. a security guard attempting to stop the robber was knocked unconscious in a struggle. however, the guard managed to pull the hat from the robber's head. witness accounts and security tapes led police to arrest three possible suspects. none of the suspects have alibis, but police are not certain which man is the robber. using hair samples from the hat recovered by the security guard, the crime lab did a southern blot test. hair samples were also taken from each suspect. use the suspects' hair samples to determine the guilty party. suspect a tccatcca / tccatccatcca / tcca / ggcttacctataagg / tggatggatggatggatgga suspect b tccatcca / tccatccaattg / tcca / tccatccatccatccatcca / tggatggatggatgga suspect c ttagcta / ccggtatga / aggt / cgttatcggatata / ggttaggacctatcgataga probe aggt questions answer these following questions in the essay box below. a. which suspect most likely committed the robbery? b. how do you know?
Answers: 1
You know the right answer?
In which direction does water move across membranes, up or down the concentration gradient?
Define...
Questions
![question](/tpl/images/cats/geografiya.png)
![question](/tpl/images/cats/biologiya.png)
![question](/tpl/images/cats/geografiya.png)
![question](/tpl/images/cats/geografiya.png)
![question](/tpl/images/cats/geografiya.png)
![question](/tpl/images/cats/istoriya.png)
![question](/tpl/images/cats/geografiya.png)
Geography, 04.07.2019 21:20
![question](/tpl/images/cats/mat.png)
![question](/tpl/images/cats/geografiya.png)
Geography, 04.07.2019 21:20
![question](/tpl/images/cats/geografiya.png)
![question](/tpl/images/cats/health.png)
![question](/tpl/images/cats/geografiya.png)
![question](/tpl/images/cats/istoriya.png)
History, 04.07.2019 21:20
![question](/tpl/images/cats/geografiya.png)
![question](/tpl/images/cats/istoriya.png)
History, 04.07.2019 21:20
![question](/tpl/images/cats/geografiya.png)
![question](/tpl/images/cats/mat.png)
Mathematics, 04.07.2019 21:20
![question](/tpl/images/cats/geografiya.png)
![question](/tpl/images/cats/geografiya.png)