Robert is studying a long list of letters. The letters represent the order of nitrogenous bases in a molecule of mRNA. The first several bases in the list are shown below.
AUGCCACAGGUUCAUCCGAA…
To identify the amino acid sequence encoded by the mRNA, which would be the most useful first step for Robert to follow?
A. Calculate the frequencies of each letter.
B. Count the number of letters in the list.
C. Separate the list into three-letter "words."
D. Separate the list into two-, three- and four-letter "words."
Answers: 3
Biology, 21.06.2019 20:00
The images show the wings of a bat and a bee. from this evidence, what can you conclude about the evolutionary relationship between these organisms? a. the wing structures of the bat and the bee are different, indicating they didn’t inherit wings from a common ancestor. b. the wing structures of the bat and the bee are different, indicating they inherited wings from a common ancestor. c. the functions of bat wings and bee wings are the same, indicating they obtained wings from a common ancestor. d. the functions of bat wings and bee wings are different, indicating they didn’t obtain wings from a common ancestor.
Answers: 3
Biology, 22.06.2019 08:50
Iwill make you brainliest pleeze answer this fast i have to turn it in really soon brainliest promise easy question 6th grade ! a weather map shows a high pressure system with circles around it. what does this mean? a) an occluded front b) areas of equal altitude c) areas of equal pressure d) a stationary front
Answers: 2
Biology, 22.06.2019 14:00
Which material is commonly used as a culture medium for living cells
Answers: 2
Biology, 22.06.2019 23:00
Identifies and describes 3-4 components of the endocrine system (10 points) transfers meaning from one subject (endocrine system) to another (scenario/example) (10 points)
Answers: 1
Robert is studying a long list of letters. The letters represent the order of nitrogenous bases in a...
English, 17.02.2020 20:12
Mathematics, 17.02.2020 20:12
Mathematics, 17.02.2020 20:13
Mathematics, 17.02.2020 20:13