Biology, 08.12.2020 19:40 bhjbh7ubb

2. A person uses a screwdriver to turn a screw and insert it into a piece of wood. The person applies a force of 20 newtons to the screwdriver and turns the handle of the screwdriver a total distance of 0.5 meter. How would these numbers be different with a hammer and a nail instead of a screwdriver and a screw? The force applied would be greater, but the distance would be shorter.

The force applied would be the same, but the distance would be greater.

The force applied would be less, but the distance would be greater.

The force applied would be the same, but the distance would be shorter.

3.
Force and Work Unit Test
3 of 14Items
Item 3
Use the diagram of the pulley system to complete the statement.

An illustration shows a system of two pulleys lifting a block.

In this pulley system, the pulleys will the mechanical force required to lift the block and will change the .

(1 point)

increase; the direction of the force

increase; the weight of the block

decrease; the direction of the force

decrease; the weight of the block

Answers: 2

Show answers

Another question on Biology

Biology, 22.06.2019 01:30

Coat color in cats is determined by genes at several different loci. at one locus on the x chromosome, one allele (x ) encodes black fur and another allele (xo) encodes orange fur. females can be black (x x ), orange (xoxo), or a mixture of orange and black called tortoiseshell (x xo). males are either black (x y) or orange (xoy). bill has a female tortoiseshell cat named patches. one night, patches escapes from bill\'s house, spends the night out, and mates with a stray male. patches later gives birth to the following kittens: one orange male, one black male, two tortoiseshell females, and one orange female. what are the genotypes of patches, the stray male, and the kittens?

Answers: 3

Answer

Biology, 22.06.2019 08:00

How water is moving through the ecosystem ?

Answers: 2

Answer

Biology, 22.06.2019 09:00

Describe the relationship and movement between temperature and density in a convection cell. make sure you identify the direction of travel

Answers: 3

Answer

Biology, 22.06.2019 12:00

Due i have no idea on this brainliest to the best answer. case #28104 last month, hudson national bank was robbed by an unidentified man. the robber wore gloves, a hat, and a bandana that covered his face. a security guard attempting to stop the robber was knocked unconscious in a struggle. however, the guard managed to pull the hat from the robber's head. witness accounts and security tapes led police to arrest three possible suspects. none of the suspects have alibis, but police are not certain which man is the robber. using hair samples from the hat recovered by the security guard, the crime lab did a southern blot test. hair samples were also taken from each suspect. use the suspects' hair samples to determine the guilty party. suspect a tccatcca / tccatccatcca / tcca / ggcttacctataagg / tggatggatggatggatgga suspect b tccatcca / tccatccaattg / tcca / tccatccatccatccatcca / tggatggatggatgga suspect c ttagcta / ccggtatga / aggt / cgttatcggatata / ggttaggacctatcgataga probe aggt questions answer these following questions in the essay box below. a. which suspect most likely committed the robbery? b. how do you know?

Answers: 1

Answer

You know the right answer?

2. A person uses a screwdriver to turn a screw and insert it into a piece of wood. The person applie...

Questions