Select all the correct answers. This sequence encodes for a particular protein that helps bacteria move. A mutation occurs in the sequence, leading to a faulty protein. Identify the sequences where the mutation might have taken place.

ATTTGCatactaccGGGC

The lowercase letters are the noncoding region, and the capital letters are the protein coding region.

1) ATTTAGCatactacGGGC
2) ATTTGCatactgaccGGGC
3) ATTTGCaatactaccGGGC
4) ATTTGCaactaccGGGC
5) ATGAATGCatactaccGGGC

Which technically is nasa developing that will astronauts reach mars

Reactants undergo chemical reaction to form products. this chemical equation represents one such reaction. the coefficient for one of the reactants or products is incorrect. which part of the chemical equation is incorrect?

Due i have no idea on this brainliest to the best answer. case #28104 last month, hudson national bank was robbed by an unidentified man. the robber wore gloves, a hat, and a bandana that covered his face. a security guard attempting to stop the robber was knocked unconscious in a struggle. however, the guard managed to pull the hat from the robber's head. witness accounts and security tapes led police to arrest three possible suspects. none of the suspects have alibis, but police are not certain which man is the robber. using hair samples from the hat recovered by the security guard, the crime lab did a southern blot test. hair samples were also taken from each suspect. use the suspects' hair samples to determine the guilty party. suspect a tccatcca / tccatccatcca / tcca / ggcttacctataagg / tggatggatggatggatgga suspect b tccatcca / tccatccaattg / tcca / tccatccatccatccatcca / tggatggatggatgga suspect c ttagcta / ccggtatga / aggt / cgttatcggatata / ggttaggacctatcgataga probe aggt questions answer these following questions in the essay box below. a. which suspect most likely committed the robbery? b. how do you know?